pmid
stringclasses 967
values | doi
stringlengths 13
29
| title
stringlengths 36
230
| abstract
stringclasses 1
value | year
stringdate 1997-01-01 00:00:00
2023-01-01 00:00:00
| fig_label
stringclasses 75
values | caption
stringlengths 0
63.2k
| fig_href
stringlengths 48
50
| entities
listlengths 1
94
|
|---|---|---|---|---|---|---|---|---|
27113762
|
10.15252/embr.201541643
|
SIRT5 promotes IDH2 desuccinylation and G6PD deglutarylation to enhance cellular antioxidant defense
|
2016
|
Figure 4
|
<p><strong>Figure 4. SIRT5 </strong><strong>desuccinylase</strong><strong> activity, but not its expression, is regulated by oxidative stimuli</strong></p>
<p><strong>(A-B) </strong>SIRT5 expression is not affected by chemical oxidant treatment. HEK293T cells were treated with Paraquat (A) or H<sub>2</sub>O<sub>2</sub> (B) for the indicated periods. The mRNA and protein expression of endogenous SIRT5 were determined by quantitative real-time PCR and western blot analysis, respectively. The results are average ± SD of 3 independent experiments. n.s.: not significant (two-tailed unpaired t-test).</p>
<p><strong>(C) </strong>Schematic representation of the experimental workflow for Figs. 4D and 4E.</p>
<p><strong>(D)</strong> The desuccinylase activity of SIRT5 is stimulated by oxidative stimuli. Flag-SIRT5 was ectopically expressed in HEK293T cells. The transfected cells were treated with increased concentrations of Paraquat or H<sub>2</sub>O<sub>2</sub> for the indicated periods. Flag-SIRT5 was purified by immunoprecipitation with Flag beads, eluted with Flag peptide, and then subjected to the desuccinylase activity assay as described in ‘Materials and Methods’. The SIRT5 desuccinylase activity was normalized against its protein level. The results are average ± SD of 3 independent experiments *p<0.05, ***p<0.001 (two-tailed unpaired t-test).</p>
<p><strong>(E)</strong> <em>In vitro</em> incubation with chemical oxidants does not affect the desuccinylase activity of SIRT5. Flag-tagged SIRT5 was ectopically expressed in HEK293T cells, and then purified by immunoprecipitation with Flag-beads and eluted with Flag peptide. The purified Flag-SIRT5 was treated with increased concentrations of Paraquat or H<sub>2</sub>O<sub>2</sub> at room temperature for 1 hr, and then subjected to the desuccinylase activity assay as described in ‘Materials and Methods’. The SIRT5 desuccinylase activity was normalized against its protein level. The results are average ± SD of 3 independent experiments. n.s.: not significant (two-tailed unpaired t-test).</p>
<p><strong>(F) </strong>Chemical oxidants enhance the ability of SIRT5 to activate IDH2. Flag-SIRT5 was ectopically expressed in HEK293T cells, and the transfected cells were treated with increased concentrations of Paraquat or H<sub>2</sub>O<sub>2</sub> for the indicated periods. Flag-SIRT5 was purified by immunoprecipitation with Flag beads, eluted with Flag peptide, and then incubated with purified Flag-IDH2 <em>in vitro</em>. IDH2 enzyme activity was measured as described in ‘Materials and Methods’, normalized by its protein level. The results are average ± SD of 3 independent experiments **p<0.01, ***p<0.001 (two-tailed unpaired t-test).</p>
<p><strong>(G) </strong>A proposed model for a role of SIRT5 in mediating oxidative stress to increase IDH2 and G6PD activities, NADPH production, and cellular protection. SIRT5 is activated by oxidative stress by a yet unknown mechanism. The active SIRT5 stimulates IDH2 and G6PD by desuccinylation and deglutarylation, respectively, thereby increasing NADPH production and protecting cells from ROS damage.</p>
|
https://api.sourcedata.io/file.php?figure_id=7263
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "23408",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23408",
"original_type": "gene",
"role": "assayed",
"text": "SIRT5",
"type": "geneprod",
"uniprot_ids": [
"Q9NXA8",
"A0A7P0T9N1",
"A0A7P0Z4N6"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NXA8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SIRT5",
"type": "geneprod",
"uniprot_ids": [
"Q9NXA8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NXA8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SIRT5",
"type": "geneprod",
"uniprot_ids": [
"Q9NXA8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NXA8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SIRT5",
"type": "geneprod",
"uniprot_ids": [
"Q9NXA8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NXA8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SIRT5",
"type": "geneprod",
"uniprot_ids": [
"Q9NXA8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NXA8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SIRT5",
"type": "geneprod",
"uniprot_ids": [
"Q9NXA8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NXA8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SIRT5",
"type": "geneprod",
"uniprot_ids": [
"Q9NXA8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NXA8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SIRT5",
"type": "geneprod",
"uniprot_ids": [
"Q9NXA8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NXA8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SIRT5",
"type": "geneprod",
"uniprot_ids": [
"Q9NXA8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NXA8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SIRT5",
"type": "geneprod",
"uniprot_ids": [
"Q9NXA8"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23408",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23408",
"original_type": "gene",
"role": "intervention",
"text": "SIRT5",
"type": "geneprod",
"uniprot_ids": [
"Q9NXA8",
"A0A7P0T9N1",
"A0A7P0Z4N6"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23408",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23408",
"original_type": "gene",
"role": "intervention",
"text": "SIRT5",
"type": "geneprod",
"uniprot_ids": [
"Q9NXA8",
"A0A7P0T9N1",
"A0A7P0Z4N6"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23408",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23408",
"original_type": "gene",
"role": "intervention",
"text": "SIRT5",
"type": "geneprod",
"uniprot_ids": [
"Q9NXA8",
"A0A7P0T9N1",
"A0A7P0Z4N6"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P48735",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IDH2",
"type": "geneprod",
"uniprot_ids": [
"P48735"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P48735",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IDH2",
"type": "geneprod",
"uniprot_ids": [
"P48735"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P48735",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IDH2",
"type": "geneprod",
"uniprot_ids": [
"P48735"
]
}
] |
|
10.15252/embr.202051632
|
N(6)-methyladenosine-binding protein YTHDF1 suppresses EBV replication and promotes EBV RNA decay
|
2021
|
Figure 2
|
<p><strong>Figure 2. The BZLF1 mRNA is m<sup>6</sup>A modified</strong></p><p><strong>A.</strong> m<sup>6</sup>A peak distribution of <em>BZLF1</em> in different EBV infection stages was analyzed based on MeRIP-seq data. The data presented from the top down are the EBV acute infected (24 hpi) NPEC1-Bmi1 sphere-like cells (NPEC-sp), and HK1 cells; latently infected CNE2EBV cells; and CNE2EBV cells with reactivated EBV induced using NaB alone or TPA/NaB together. For acute EBV infection, RNA was harvested at 24 hpi. TPA (30 ng/ml) and NaB (2 mM) were used alone or together to treat the cells for 24 h to reactivate EBV. The PA-m<sup>6</sup>A-seq peak is indicated by the green box, and the potential m<sup>6</sup>A sites on the indicated sequence are shown in red. The region indicated by the dotted box was PCR-amplified to construct the wild-type BZLF1<sup>1-262nt</sup> plasmid.</p><p><strong>B.</strong> The <em>BZLF1</em> m<sup>6</sup>A levels were measured using MeRIP-qPCR in CNE2EBV, Raji and B95-8 cells with latent EBV infection or lytic reactivation. TPA (30 ng/ml) and NaB (2 mM) were used to treat the cells for 24 h to reactivate EBV. The cellular RNA was harvested for MeRIP-qPCR assays. The fold enrichment was determined by calculating the 2<sup>-ΔCt</sup> of the MeRIP sample relative to the input sample. The mean value of the results in mock-treated cells was normalized to 1. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. **<em>P</em><0.01 and ***<em>P</em><0.001 compared to mock-treated cells according to unpaired Student's <em>t</em>-test.</p><p><strong>C.</strong> The relative product abundance of SELECT at the predicted m<sup>6</sup>A sites in the latently infected or lytic reactivated CNE2EBV cells. TPA (30 ng/ml) and NaB (2 mM) were used to treat the CNE2EBV cells for 24 h to reactivate EBV. The mean value of results in mock-treated cells was normalized to 1. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. ***<em>P</em><0.001 compared to the mock-treated group according to unpaired Student's <em>t</em>-test.</p><p><strong>D.</strong> The validation of the <em>BZLF1</em> m<sup>6</sup>A peaks by MeRIP-qPCR in PDXs, NPC1 and NPN. One nontumor control biopsy (NPN), one NPC sample (NPC1), and two PDX samples (PDX-NPC04L and PDX-NPC03W) were used to perform the MeRIP-qPCR assays. The fold enrichment was determined by calculating the 2<sup>-ΔCt</sup> of the MeRIP sample relative to the input sample. The data represent the means ± SD of n=3 technical replicates.</p><p><strong>E.</strong> Construction of the WT-BZLF1 and mut-BZLF1 plasmids. The WT-BZLF1 plasmid was constructed by inserting the BZLF1<sup>1-262nt</sup> fragment (1-262 nt of the BZLF1 mRNA) into pcDNA3.1+ plasmid. The mut-BZLF1 plasmid was constructed by introducing A>T mutations at the putative m<sup>6</sup>A sites of BZLF1<sup>1-262nt</sup>.</p><p><strong>F.</strong> The IgG or anti-m<sup>6</sup>A antibody enrichment of the WT-BZLF1 and mut-BZLF1 mRNAs was measured by RIP-qPCR in the CNE2EBV cell lines. Blank indicates CNE2EBV cells without plasmids transfection. The fold enrichment was determined by calculating the 2<sup>-ΔCt</sup> of the RIP sample relative to the input sample. The mean value of the m<sup>6</sup>A enrichment level on WT-BZLF1 mRNA was normalized to 1. Experiments were independently repeated four times, and the results are represented as the means ± SD of n=4 biological replicates. ***<em>P</em><0.001 according to unpaired Student's <em>t</em>-test.</p>
|
https://api.sourcedata.io/file.php?figure_id=42476
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "3783744",
"ext_tax_ids": "10376",
"ext_tax_names": "Human gammaherpesvirus 4",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3783744",
"original_type": "gene",
"role": "assayed",
"text": "BZLF1",
"type": "geneprod",
"uniprot_ids": [
"K9URC5",
"P03206"
]
}
] |
||
10.15252/embr.202051632
|
N(6)-methyladenosine-binding protein YTHDF1 suppresses EBV replication and promotes EBV RNA decay
|
2021
|
Figure 3
|
<p><strong>Figure 3. Knockdown of YTHDF1 promotes EBV infection and replication</strong></p><p><strong>A.</strong> The knockdown efficiency of <em>METTL3</em>, <em>METTL14</em>, <em>FTO</em>, <em>YTHDF1</em>, <em>YTHDF2</em> and <em>YTHDF3</em> in HK1 and CNE2EBV cells at 24 h after siRNA transfection was determined by western blot analysis. ACTB was used as loading control.</p><p><strong>B.</strong> The EBV infection efficiency in HK1 cells transfected with the indicated siRNAs was analyzed by FACS. The cells were infected with EBV-GFP virus at 24 h after siRNA transfection. The ratio of GFP-positive cells was quantified by FACS at 24 hpi. The mean value of the GFP-positive rates in the siNC transfected HK1 cells was normalized to 1. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. ns<em>,</em> **<em>P</em><0.01 and ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p><p><strong>C.</strong> The ratio of GFP-positive HK1 cells transfected with ALKBH5-specific siRNAs (siA5-1 and siA5-2) or the siNC control, was quantified using FACS. The experiments were performed similarly as described for (<strong>B</strong>) except for the different siRNA transfection. At 24 h post siRNA transfection, the protein level of ALKBH5 was determined by western blot analysis. ACTB was used as loading control. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p><p><strong>D.</strong> The GFP-positive cells of the EBV reactivated CNE2EBV cells transfected with indicated siRNAs. After 24 h of siRNA transfection, the cells were induced with NaB (2 mM) for 24 h. The GFP-positive cells were quantified using FACS. The mean value of the GFP-positive rates in the siNC transfected cells was normalized to 1. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. ns<em>,</em> *<em>P</em><0.05, **<em>P</em><0.01 and ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p><p><strong>E.</strong> The GFP-expressed cells were visualized by fluorescence microscopy after YTHDF1 knockdown in HK1 cells following EBV infection and CNE2EBV cells with induced EBV reactivation. The experiments were performed similarly as described for (<strong>B</strong>) in HK1 cells and (<strong>D</strong>) in CNE2EBV cells. Representative data from three independent experiments are shown. Scale bars: 50 μm.</p><p><strong>F.</strong> The knockdown efficiency of <em>YTHDF1</em> in HK1, CNE2EBV and C666 cells, transfected with YTHDF1-specific siRNAs (siY1-1 and siY1-2) or the siNC control for 24 h, was determined by qRT-PCR. The mRNA levels of YTHDF1 were normalized to the housekeeping gene ACTB. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. *<em>P</em><0.05, **<em>P</em><0.01 and ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p><p><strong>G, H.</strong> The HK1 cells were transfected with YTHDF1-specific siRNA (siY1-1 and siY1-2) or the siNC control for 24 h, and then infected with EBV-GFP virus. At 24 hpi, the ratio of GFP-positive cells was quantified using FACS (<strong>G</strong>), and the number of EBV copies was quantified using qPCR (<strong>H</strong>). The EBV copies were determined using a specific primers targeting BamHI-W fragment region of EBV, and GAPDH was used as a reference genome copy. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates **<em>P</em><0.01 and ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p><p><strong>I, J.</strong> CNE2EBV cells were transfected with YTHDF1-specific siRNA (siY1-1 and siY1-2) or the siNC control for 24 h, and then induced with NaB (2 mM). At 24 h post NaB-induced EBV reactivation, the GFP-positive cells <strong>(I)</strong> and the EBV copies <strong>(J)</strong> were quantified as described for <strong>(G</strong> and <strong>H)</strong>. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p><p><strong>K.</strong> The relative number of EBV copies in C666 cells transfected with the YTHDF1-specific siRNAs (siY1-1 and siY1-2) or the siNC control was quantified using qPCR. At 24 h after siRNA transfection, the EBV copies were quantified as described for <strong>(H)</strong>. The mean value of EBV copies in the siNC cells was normalized to 1. Experiments were independently repeated four times, and the results are represented as the means ± SD of n=4 biological replicates. *<em>P</em><0.05 and **<em>P</em><0.01 compared to siNC according to unpaired Student's <em>t</em>-test.</p><p><strong>L.</strong> The relative production of EBV virions in CNE2EBV cells transfected with YTHDF1-specific siRNAs (siY1-1 and siY1-2) or the siNC control following EBV reactivation, was measured by qPCR. After 24 h of siRNA transfection, CNE2EBV cells were treated with NaB (2 mM) for 24 h, and the DNA from the cell-free culture supernatant was harvested for qPCR. The number of EBV copies in the supernatant of the cells was quantified by qPCR using specific primers targeting BamHI-W fragment region of EBV. The mean value of EBV copies in the siNC cells was normalized to 1. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. *<em>P</em><0.05 and **<em>P</em><0.01 compared to siNC according to unpaired Student's <em>t</em>-test.</p><p><strong>M.</strong> The relative EBV production in C666 cells transfected with YTHDF1-specific siRNAs (siY1-1 and siY1-2) or the siNC control was measured by qPCR. The DNA from the cell-free culture supernatant was harvested at 24 h after siRNA transfection. The number of EBV copies in the supernatant of the cells was quantified by qPCR using specific primers targeting BamHI-W fragment region of EBV. The mean value of EBV copies in the siNC cells was normalized to 1. Experiments were independently repeated four times, and the results are represented as the means ± SD of n=4 biological replicates. **<em>P</em><0.01 and ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p><p><strong>N.</strong> FACS analysis of gp350 expression in CNE2EBV cells transfected with YTHDF1-specific siRNA (siY1-1 and siY1-2) or the siNC control following EBV reactivation. To measure gp350 expression in the reactivated CNE2EBV cells, cells were stained with anti-gp350 mAb (72A1) followed by an Alexa Fluor 594-conjugated secondary anti-mouse antibody and analyzed by FACS. The quantification of the ratio of GFP-positive and gp350-positive (GFP<sup>+</sup>/gp350<sup>+</sup>) cells from three independent experiments was shown. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. **<em>P</em><0.01 and ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p>
|
https://api.sourcedata.io/file.php?figure_id=42477
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "54915",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54915",
"original_type": "gene",
"role": "intervention",
"text": "Y1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54915",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54915",
"original_type": "gene",
"role": "intervention",
"text": "Y1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54915",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54915",
"original_type": "gene",
"role": "intervention",
"text": "YTHDF1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
}
] |
||
10.15252/embr.202051632
|
N(6)-methyladenosine-binding protein YTHDF1 suppresses EBV replication and promotes EBV RNA decay
|
2021
|
Figure 4
|
<p><strong>Figure 4. YTHDF1 knockdown promotes the expression of BZLF1 and BRLF1</strong></p><p><strong>A.</strong> The relative mRNA levels of <em>BZLF1</em> and <em>BRLF1</em> at 24 hpi following EBV infection of HK1 cells transfected with the YTHDF1-specific siRNAs (siY1-1 and siY1-2) or the siNC control. After 24 h of siRNA transfection, HK1 cells were infected with EBV-GFP and analyzed by qRT-PCR at 24 hpi. All the gene expression levels were normalized to the housekeeping gene ACTB. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. *<em>P</em><0.05 and **<em>P</em><0.01 compared to siNC according to unpaired Student's <em>t</em>-test.</p><p><strong>B.</strong> The relative mRNA levels of <em>BZLF1</em> and <em>BRLF1</em> in the latently infected or reactivated (24 h post NaB treatment) CNE2EBV cells transfected with the YTHDF1-specific siRNAs (siY1-1 and siY1-2) or the siNC control. After 24 h of siRNA transfection, CNE2EBV cells were treated with NaB (2 mM) or mock for 24 h, followed by qRT-PCR analysis. All the gene expression levels were normalized to the housekeeping gene ACTB. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. *<em>P</em><0.05, **<em>P</em><0.01 and ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p><p><strong>C.</strong> The relative mRNA levels of <em>BZLF1</em> and <em>BRLF1</em> in C666 cells transfected with the YTHDF1-specific siRNAs (siY1-1 and siY1-2) or the siNC control. The total RNA was harvested from the cells at 24 h after siRNA transfection. All gene expression levels were normalized to the housekeeping gene ACTB. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. *<em>P</em><0.05, **<em>P</em><0.01 and ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p><p><strong>D.</strong> The protein levels of YTHDF1 and BZLF1 in the EBV-infected (24 hpi) HK1 cells, CNE2EBV cells with induced EBV reactivation (24 h post NaB treatment) and C666 cells transfected with YTHDF1-specific siRNA (siY1-1 and siY1-2) or the siNC control. The whole-cell protein was extracted at same time as the RNA.</p><p><strong>E.</strong> The relative mRNA expression levels of YTHDF1 in CNE2EBV cells following EBV reactivation (24 h post NaB treatment), EBV infected HK1 or NPEC2-Bmi1 cells at 24 hpi. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. **<em>P</em><0.01 according to unpaired Student's <em>t</em>-test.</p><p><strong>F.</strong> The protein level of YTHDF1, BZLF1 and ACTB in CNE2EBV cells following EBV reactivation (24 h post-NaB treatment), EBV infected HK1 or NPEC2-Bmi1 cells at 24 hpi. The whole-cell protein was extracted at same time as the RNA.</p>
|
https://api.sourcedata.io/file.php?figure_id=42478
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "3783727",
"ext_tax_ids": "10376",
"ext_tax_names": "Human gammaherpesvirus 4",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3783727",
"original_type": "gene",
"role": "assayed",
"text": "BRLF1",
"type": "geneprod",
"uniprot_ids": [
"A0A0B6VPY0",
"P03209"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "3783744",
"ext_tax_ids": "10376",
"ext_tax_names": "Human gammaherpesvirus 4",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3783744",
"original_type": "gene",
"role": "assayed",
"text": "BZLF1",
"type": "geneprod",
"uniprot_ids": [
"K9URC5",
"P03206"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54915",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54915",
"original_type": "gene",
"role": "intervention",
"text": "Y1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54915",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54915",
"original_type": "gene",
"role": "intervention",
"text": "Y1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54915",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54915",
"original_type": "gene",
"role": "intervention",
"text": "YTHDF1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3KSS8",
"ext_tax_ids": "10376",
"ext_tax_names": "Human gammaherpesvirus 4",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BZLF1",
"type": "geneprod",
"uniprot_ids": [
"Q3KSS8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9BYJ9",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "YTHDF1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
}
] |
||
10.15252/embr.202051632
|
N(6)-methyladenosine-binding protein YTHDF1 suppresses EBV replication and promotes EBV RNA decay
|
2021
|
Figure 5
|
<p><strong>Figure 5. Knockdown of YTHDF1 prolongs the half-life of EBV transcripts</strong></p><p><strong>A</strong>, <strong>B.</strong> The relative YTHDF1-RIP enrichment ratio of the indicated genes in C666 cells (<strong>A</strong>) and CNE2EBV cells with induced EBV reactivation (24 h post TPA/NaB treatment) (<strong>B</strong>). The EEF1A1 mRNA known to contain m<sup>6</sup>A sites and RPL30 mRNA containing no m<sup>6</sup>A modification were used as positive and negative controls, respectively. BALF1 and BCRF1 containing no m<sup>6</sup>A modification, identified in this study, were used as viral negative controls. The fold enrichment was determined by calculating the 2<sup>-ΔCt</sup> of the RIP sample relative to the input sample. The mean of the fold enrichment by IgG was normalized to 1. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. ns<em>,</em> **<em>P</em><0.01 and ***<em>P</em><0.001 compared to IgG according to unpaired Student's <em>t</em>-test.</p><p><strong>C.</strong> The relative Myc-RIP enrichment ratios of wild-type and mutant BZLF1<sup>1-262nt</sup> mRNA in CNE2EBV cells. CNE2EBV cells were co-transfected with wild-type or mutant BZLF1<sup>1-262nt</sup> and myc-YTHDF1 or vector control for 24 h. The fold Myc-RIP enrichment was determined by calculating the 2<sup>-ΔCt</sup> of the RIP sample relative to the input sample. The mean of the fold Myc-RIP enrichment level on WT-BZLF1 mRNA was normalized to 1. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. **<em>P</em><0.01 according to unpaired Student's <em>t</em>-test.</p><p><strong>D.</strong> The relative enrichment of the BZLF1 and BRLF1 mRNA in CNE2EBV cells with transfected with siYTHDF2, siYTHDF3 or siNC siRNA following EBV reactivation. After 24 h of siRNA transfection, CNE2EBV cells were treated with TPA (30 ng/ml) and NaB (2 mM) for 24 h. The RIP assays were performed using YTHDF1-specific antibody or IgG control in these cells. Fold enrichment was determined by calculating the 2<sup>-ΔCt</sup> of the RIP sample relative to the input sample. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. ns, not significant according to unpaired Student's <em>t</em>-test.</p><p><strong>E</strong>, <strong>F.</strong> The relative m<sup>6</sup>A and YTHDF1 enrichment of the BZLF1 (<strong>E</strong>) or BRLF1 (<strong>F</strong>) mRNAs measured in CNE2EBV cells transfected with the METTL14-specific siRNAs (siM14) or siNC control following EBV reactivation. After 24 h of siRNA transfection, CNE2EBV cells were treated with TPA (30 ng/ml) and NaB (2 mM) for 24 h, followed by MeRIP and RIP assays. The fold enrichment was determined by calculating the 2<sup>-ΔCt</sup> of the RIP sample relative to the input sample. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. *<em>P</em><0.05, **<em>P</em><0.01 and ***<em>P</em><0.001 according to unpaired Student's <em>t</em>-test.</p><p><strong>G.</strong> Residual mRNA levels of <em>BZLF1</em> and <em>BRLF1</em> after termination of transcription via ActD treatment in C666 cells transfected with YTHDF1-specific siRNAs or the siNC control. After 24 h of siRNA transfection, the C666 cells were treated with ActD and the mRNA levels analyzed by qRT-PCR. The relative mRNA level at 0 h after the ActD treatment was normalized to 1. Experiments were independently repeated four times, and the results are represented as the means ± SD of n=4 biological replicates.</p><p><strong>H.</strong> Residual mRNA levels of <em>BZLF1</em> and <em>BRLF1</em> after termination of transcription via ActD treatment in CNE2EBV cells transfected with YTHDF1-specific siRNAs or the siNC control following EBV reactivation. After 24 h of siRNA transfection, CNE2EBV cells were induced with NaB (2 mM) for 24 h, treated with ActD and analyzed by qRT-PCR. The relative mRNA level at 0 h after the ActD treatment was normalized to 1. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates.</p>
|
https://api.sourcedata.io/file.php?figure_id=42479
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "3783727",
"ext_tax_ids": "10376",
"ext_tax_names": "Human gammaherpesvirus 4",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3783727",
"original_type": "gene",
"role": "assayed",
"text": "BRLF1",
"type": "geneprod",
"uniprot_ids": [
"A0A0B6VPY0",
"P03209"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "3783744",
"ext_tax_ids": "10376",
"ext_tax_names": "Human gammaherpesvirus 4",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3783744",
"original_type": "gene",
"role": "assayed",
"text": "BZLF1",
"type": "geneprod",
"uniprot_ids": [
"K9URC5",
"P03206"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "51441",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "51441",
"original_type": "gene",
"role": "intervention",
"text": "YTHDF2",
"type": "geneprod",
"uniprot_ids": [
"Q9Y5A9"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "253943",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "253943",
"original_type": "gene",
"role": "intervention",
"text": "YTHDF3",
"type": "geneprod",
"uniprot_ids": [
"Q7Z739",
"A0A024R7W5",
"A0A087WY31",
"B4DPX9",
"Q8NA80"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9BYJ9",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "YTHDF1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "3783727",
"ext_tax_ids": "10376",
"ext_tax_names": "Human gammaherpesvirus 4",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3783727",
"original_type": "gene",
"role": "assayed",
"text": "BRLF1",
"type": "geneprod",
"uniprot_ids": [
"A0A0B6VPY0",
"P03209"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "3783744",
"ext_tax_ids": "10376",
"ext_tax_names": "Human gammaherpesvirus 4",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3783744",
"original_type": "gene",
"role": "assayed",
"text": "BZLF1",
"type": "geneprod",
"uniprot_ids": [
"K9URC5",
"P03206"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "57721",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "57721",
"original_type": "gene",
"role": "intervention",
"text": "M14",
"type": "geneprod",
"uniprot_ids": [
"Q9HCE5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "57721",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "57721",
"original_type": "gene",
"role": "intervention",
"text": "METTL14",
"type": "geneprod",
"uniprot_ids": [
"Q9HCE5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9BYJ9",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "YTHDF1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
}
] |
||
10.15252/embr.202051632
|
N(6)-methyladenosine-binding protein YTHDF1 suppresses EBV replication and promotes EBV RNA decay
|
2021
|
Figure 6
|
<p><strong>Figure 6. YTHDF1 interacts with the RNA degradation complex</strong></p><p><strong>A.</strong> The interaction partners of YTHDF1 were identified by pull-down assays and mass spectrometry. The Flag-YTHDF1 pull-down assay was performed in CNE2EBV cells transfected with a plasmid encoding Flag-tagged YTHDF1. The proteins in the differentially abundant bands were identified by mass spectrometry.</p><p><strong>B</strong>, <strong>C.</strong> The interactions between YTHDF1 and ZAP (<strong>B</strong>) or DDX17 (<strong>C</strong>) were measured by co-IP in 293T cells. The results were detected using specific antibodies.</p><p><strong>D.</strong> The interaction between YTHDF1 and DCP2 was detected by co-IP in 293T cells.</p><p><strong>E.</strong> The interactions between endogenous YTHDF1 and ZAP, DDX17 or DCP2 were detected by endogenous IP using a YTHDF1-specific antibody in CNE2EBV cells.</p><p><strong>F. The interactions between</strong> endogenous YTHDF1 and ZAP, DDX17 or DCP2 were detected by endogenous IP assays in CNE2EBV cells transfected with YTHDF2-, YTHDF3-specific siRNAs or the siNC control. YTHDF1, YTHDF2, YTHDF3, ZAP, DDX17, and DCP2 were detected in the immunoprecipitated complexes using specific antibodies, respectively.</p>
|
https://api.sourcedata.io/file.php?figure_id=42480
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IU60",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DCP2",
"type": "geneprod",
"uniprot_ids": [
"Q8IU60"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9BYJ9",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "YTHDF1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "51441",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "51441",
"original_type": "gene",
"role": "intervention",
"text": "YTHDF2",
"type": "geneprod",
"uniprot_ids": [
"Q9Y5A9"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "253943",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "253943",
"original_type": "gene",
"role": "intervention",
"text": "YTHDF3",
"type": "geneprod",
"uniprot_ids": [
"Q7Z739",
"A0A024R7W5",
"A0A087WY31",
"B4DPX9",
"Q8NA80"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IU60",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DCP2",
"type": "geneprod",
"uniprot_ids": [
"Q8IU60"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IU60",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DCP2",
"type": "geneprod",
"uniprot_ids": [
"Q8IU60"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q92841",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DDX17",
"type": "geneprod",
"uniprot_ids": [
"Q92841"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q92841",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DDX17",
"type": "geneprod",
"uniprot_ids": [
"Q92841"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9BYJ9",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "YTHDF1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9BYJ9",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "YTHDF1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y5A9",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "YTHDF2",
"type": "geneprod",
"uniprot_ids": [
"Q9Y5A9"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q7Z739",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "YTHDF3",
"type": "geneprod",
"uniprot_ids": [
"Q7Z739"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q7Z2W4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ZAP",
"type": "geneprod",
"uniprot_ids": [
"Q7Z2W4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q7Z2W4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ZAP",
"type": "geneprod",
"uniprot_ids": [
"Q7Z2W4"
]
}
] |
||
10.15252/embr.202051632
|
N(6)-methyladenosine-binding protein YTHDF1 suppresses EBV replication and promotes EBV RNA decay
|
2021
|
Figure 7
|
<p><strong>Figure 7. YTHDF1 promotes viral mRNA decapping by recruiting the RNA degradation complex</strong></p>
<p><strong>A.</strong> The ratios of GFP-positive HK1 cells transfected with the ZAP-, DDX17- and DCP2-specific siRNAs or the siNC control were quantified using FACS. At 24 h post siRNA transfection, the protein level of indicated genes was determined by western blot analysis. ACTB was used as loading control. The experiments were performed similarly as described in <strong>Fig 3B,</strong> except the different siRNA transfection. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. *<em>P</em><0.05, **<em>P</em><0.01 and ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p>
<p><strong>B.</strong> The GFP-positive cells in CNE2EBV cells transfected with the ZAP-, DDX17-, and DCP2-specific siRNAs or the control siRNA following EBV reactivation, were quantified using FACS. At 24 h post siRNA transfection, the protein level of indicated genes was determined by western blot analysis. ACTB was used as loading control. The experiments were performed similarly as described in <strong>Fig 3D,</strong> except the different siRNA transfection. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. **<em>P</em><0.01 and ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p>
<p><strong>C.</strong> The relative number of EBV copies in C666 cells transfected with the ZAP-, DDX17- and DCP2-specific siRNAs or the siNC control was measured using qPCR. At 24 h post siRNA transfection, the protein level of indicated genes was determined by western blot analysis. ACTB was used as loading control. The experiments were performed similarly as described in <strong>Fig 3K,</strong> except the different siRNA transfection. Experiments were independently repeated four times, and the results are represented as the means ± SD of n=4 biological replicates. **<em>P</em><0.01 and ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p>
<p><strong>D.</strong> The relative mRNA levels of <em>BZLF1</em> and <em>BRLF1</em> in C666 cells transfected with the YTHDF1-specific siRNAs (siY1-1 and siY1-2) or the siNC control. The experiments were performed similarly as described in <strong>Fig 4C</strong>. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. *<em>P</em><0.05, **<em>P</em><0.01 and ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p>
<p><strong>E.</strong> The ratio of endogenous 5'-capped BZLF1 and BRLF1 mRNAs in C666 cells at 24 h post transfection with the YTHDF1-specific siRNAs or the siNC control. The ratios of endogenous 5'-capped mRNAs were quantified by dividing the abundance of XRN1-resistant transcripts with the total amount of transcripts. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. **<em>P</em><0.01 and ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p>
<p><strong>F.</strong> The relative mRNA levels of <em>BZLF1</em> and <em>BRLF1</em> in C666 cells transfected with YTHDF1-specific siRNAs and XRN1-specific siRNAs. The C666 cells were co-transfected with YTHDF1-specific siRNAs and XRN1-specific siRNAs for 24 h. The mRNA levels were determined using qPCR. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. *<em>P</em><0.05 and **<em>P</em><0.01 compared to siNC according to unpaired Student's <em>t</em>-test.</p>
<p><strong>G.</strong> The relative enrichment of BZLF1 and BRLF1 mRNAs by ZAP, DDX17, or DCP2 in CNE2EBV cells following EBV reactivation. CNE2EBV cells were transfected with plasmids encoding myc-ZAP, myc-DDX17, myc-DCP2, or vector control. At 24 h post transfection, the cells were treated with TPA (30 ng/ml) and NaB (2 mM) for 24 h. The RIP assays were performed using Myc-beads. The fold enrichment was determined by calculating the 2<sup>-ΔCt</sup> of the RIP sample relative to the input sample. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. **<em>P</em><0.01 and ***<em>P</em><0.001 compared to Vector according to unpaired Student's <em>t</em>-test.</p>
<p><strong>H.</strong> Determination of the EBV infection efficiency in HK1 cells transfected with the XRN1-specific siRNA or the siNC control. After 24 h of siRNA transfection, HK1 cells were infected with EBV and analyzed by FACS at 24 hpi. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. ***<em>P</em><0.001 compared to siNC according to unpaired Student's <em>t</em>-test.</p>
<p><strong>I.</strong> The relative mRNA levels of <em>BZLF1</em> and <em>BRLF1</em> in the EBV-infected HK1 cells transfected with the XRN1-specific siRNA (siXRN1) or the siNC control at 24 hpi. All gene expression levels were normalized to the housekeeping gene ACTB. Experiments were independently repeated three times, and the results are represented as the means ± SD of n=3 biological replicates. *<em>P</em><0.05 and **<em>P</em><0.01 compared to siNC according to unpaired Student's <em>t</em>-test.</p>
<p> </p>
|
https://api.sourcedata.io/file.php?figure_id=42481
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "3783727",
"ext_tax_ids": "10376",
"ext_tax_names": "Human gammaherpesvirus 4",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3783727",
"original_type": "gene",
"role": "assayed",
"text": "BRLF1",
"type": "geneprod",
"uniprot_ids": [
"A0A0B6VPY0",
"P03209"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "3783744",
"ext_tax_ids": "10376",
"ext_tax_names": "Human gammaherpesvirus 4",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3783744",
"original_type": "gene",
"role": "assayed",
"text": "BZLF1",
"type": "geneprod",
"uniprot_ids": [
"K9URC5",
"P03206"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54464",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54464",
"original_type": "gene",
"role": "intervention",
"text": "XRN1",
"type": "geneprod",
"uniprot_ids": [
"Q8IZH2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54464",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54464",
"original_type": "gene",
"role": "intervention",
"text": "XRN1",
"type": "geneprod",
"uniprot_ids": [
"Q8IZH2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54915",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54915",
"original_type": "gene",
"role": "intervention",
"text": "YTHDF1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54915",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54915",
"original_type": "gene",
"role": "intervention",
"text": "YTHDF1",
"type": "geneprod",
"uniprot_ids": [
"Q9BYJ9"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "3783727",
"ext_tax_ids": "10376",
"ext_tax_names": "Human gammaherpesvirus 4",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3783727",
"original_type": "gene",
"role": "assayed",
"text": "BRLF1",
"type": "geneprod",
"uniprot_ids": [
"A0A0B6VPY0",
"P03209"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "3783744",
"ext_tax_ids": "10376",
"ext_tax_names": "Human gammaherpesvirus 4",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3783744",
"original_type": "gene",
"role": "assayed",
"text": "BZLF1",
"type": "geneprod",
"uniprot_ids": [
"K9URC5",
"P03206"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "167227",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "167227",
"original_type": "gene",
"role": "intervention",
"text": "DCP2",
"type": "geneprod",
"uniprot_ids": [
"Q8IU60"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "10521",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "10521",
"original_type": "gene",
"role": "intervention",
"text": "DDX17",
"type": "geneprod",
"uniprot_ids": [
"Q92841",
"A0A5H1ZRQ2",
"Q59F66"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "56829",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "56829",
"original_type": "gene",
"role": "intervention",
"text": "ZAP",
"type": "geneprod",
"uniprot_ids": [
"Q7Z2W4",
"C9J6P4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IU60",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DCP2",
"type": "geneprod",
"uniprot_ids": [
"Q8IU60"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q92841",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DDX17",
"type": "geneprod",
"uniprot_ids": [
"Q92841"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q7Z2W4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ZAP",
"type": "geneprod",
"uniprot_ids": [
"Q7Z2W4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54464",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54464",
"original_type": "gene",
"role": "intervention",
"text": "XRN1",
"type": "geneprod",
"uniprot_ids": [
"Q8IZH2"
]
}
] |
||
10.15252/embj.2021108780
|
Schwann cell precursors represent a neural crest-like state
with biased multipotency
|
2022
|
Figure 4
|
<p><strong>Fig. 4. CRISP-Cas9-mediated knock-down of <em>Sox8</em> in developing chicken late neural crest affects migration and differentiation of "hub" cells.</strong></p><p><strong>A)</strong> Electroporation of the control CRISPR-Cas9 plasmid (CITRINE+ cells) does not affect <em>Sox8</em> expression as seen by HCR against <em>Sox8</em>. The arrow points to the unilaterally electroporated side of the embryo. Scale bar = 200 µm.</p><p><strong>B)</strong> Validation of <em>Sox8</em> knock down (KD) using the CRISPR-Cas9 plasmid containing a <em>Sox8</em> guide-RNA by HCR. The arrow points to the unilaterally electroporated side of the embryo. Scale bar = 200 µm.</p><p><strong>C)</strong> CITRINE+ (electroporated) cells found migrating away from the neural tube after 3 days of culture following unilateral electroporation. Scale bar = 1 mm.</p><p><strong>D-E)</strong> Immunofluorescence against CITRINE (electroporated cells), SOX10 (Schwann cell precursors and Schwann cells) and ISL1 (sensory and sympathetic neurons) on embryos electroporated with either control CRISPR plasmid (D) or a CRISPR plasmid containing a guide-RNA against <em>Sox8</em> (E). CITRINE+ cells populate the developing dorsal root ganglia (DRG) and peripheral nerves. Examples of CITRINE+/SOX10+ cells shown by arrowheads. Asterisks show ventral boundary cap glia. Scale bar is 50 µm in overviews and 10 µm in insets.</p><p><strong>F)</strong> Quantification of the fate distribution of CITRINE+ cells as a % between glial (SOX10+) cells, sensory neurons (ISL1+) or neither (SOX10-/ISL1-) in the DRG of control and Sox8KD chick embryos and Sox8KD chick embryos. Biological replicates - N=3 embryos per condition (wild type versus <em>Sox8</em> KD). Data represented as mean±SEM. Statistical significance determined using the Holm-Sidak method (alpha = 0.05) (multiple t-tests, unpaired). SOX10+ cells: p=0.7901, ISL1+ cells: p=0.9206, SOX10-/ISL1- cells: p=0.9206. For statistical significance: non-significant - p-value≥0.05.</p><p><strong>G)</strong> Quantification of (left) the % of SOX10+ cells in the peripheral nerves that are CITRINE+ in control and Sox8KD chick embryos and (right) the % of PH3+ CITRINE+ cells corresponding to proliferative cells. Biological replicates - N=4 embryos per condition for SOX10+ distribution and N=2 for PH3 quantification (wild type versus <em>Sox8</em> KD). Data represented as mean±SEM. Statistical significance determined unpaired t-test with two-tailed p value. SOX10+ cells: p=0.0044, PH3+ cells: p=0.4929. For statistical significance: non-significant - p-value≥0.05, ** - p-value<0.01.</p><p><strong>H)</strong> Schematic representation of analysed anatomical locations.</p><p><strong>I)</strong> Immunofluorescence against CITRINE (electroporated cells), SOX10 (Schwann cell precursors and Schwann cells) and TH (sympathetic neurons and chromaffin cells) of the sympathoadrenal domain on control and Sox8KD embryos. CITRINE+/SOX10+ cells shown by empty arrowheads while CITRINE+/TH+ cells are shown by filled arrowheads. Scale bar = 50 µm.</p><p><strong>J)</strong> Quantification of the fate distribution of CITRINE+ cells as a % between glial (SOX10+) cells, chromaffin cells (TH+) or neither (SOX10-/TH-) in the proximity of the dorsal aorta and visceral nerve of wild type and Sox8 KD chick embryos. Biological replicates - N=4 embryos per condition. Data represented as mean±SEM. Statistical significance determined using the Holm-Sidak method (alpha = 0.05) (multiple t-tests, unpaired). SOX10+ cells: p=0.0067, TH+ cells: p=0.0067, SOX10-/TH- cells: p=0.8819. For statistical significance: non-significant - p-value≥0.05, * - p-value<0.05.</p><p>Data information: In total, 6 embryos were analyzed for the control electroporation and 7 embryos were analyzed for the <em>Sox8</em> knock down electroporation and data depicted in graphs correspond to mean±SEM per embryo (corresponding to biological replicates): 3-4 electroporated embryos were analyzed per condition (control and SOX8 knock down) with 4-5 sections stained and analyzed per embryo per region of interest (DRG, Ventral nerve, Sympathoadrenal domain). The only exception is the analysis of pH3 staining where 2 electroporated embryos were analyzed per condition with 5 sections stained and analyzed per embryo. nt: neural tube, DRG: dorsal root ganglia, sg: sympathetic ganglion, DA: dorsal aorta.</p>
|
https://api.sourcedata.io/file.php?figure_id=48473
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "395483",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "395483",
"original_type": "gene",
"role": "intervention",
"text": "Sox8",
"type": "geneprod",
"uniprot_ids": [
"P57074",
"F1P1Z5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "395483",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "395483",
"original_type": "gene",
"role": "intervention",
"text": "Sox8",
"type": "geneprod",
"uniprot_ids": [
"P57074",
"F1P1Z5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "395483",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "395483",
"original_type": "gene",
"role": "intervention",
"text": "Sox8",
"type": "geneprod",
"uniprot_ids": [
"P57074",
"F1P1Z5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "395483",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "395483",
"original_type": "gene",
"role": "intervention",
"text": "Sox8",
"type": "geneprod",
"uniprot_ids": [
"P57074",
"F1P1Z5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "395483",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "395483",
"original_type": "gene",
"role": "intervention",
"text": "Sox8",
"type": "geneprod",
"uniprot_ids": [
"P57074",
"F1P1Z5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "395483",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "395483",
"original_type": "gene",
"role": "intervention",
"text": "Sox8",
"type": "geneprod",
"uniprot_ids": [
"P57074",
"F1P1Z5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "395483",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "395483",
"original_type": "gene",
"role": "intervention",
"text": "SOX8",
"type": "geneprod",
"uniprot_ids": [
"P57074",
"F1P1Z5"
]
},
{
"ext_dbs": "Uniprot///Uniprot",
"ext_ids": "P84247///P84229",
"ext_tax_ids": "9031///9031",
"ext_tax_names": "Gallus gallus///Gallus gallus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "H3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot",
"ext_ids": "P84247///P84229",
"ext_tax_ids": "9031///9031",
"ext_tax_names": "Gallus gallus///Gallus gallus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "H3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot",
"ext_ids": "P84247///P84229",
"ext_tax_ids": "9031///9031",
"ext_tax_names": "Gallus gallus///Gallus gallus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "H3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P50211",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ISL1",
"type": "geneprod",
"uniprot_ids": [
"P50211"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P50211",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ISL1",
"type": "geneprod",
"uniprot_ids": [
"P50211"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P50211",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ISL1",
"type": "geneprod",
"uniprot_ids": [
"P50211"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P50211",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ISL1",
"type": "geneprod",
"uniprot_ids": [
"P50211"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P50211",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ISL1",
"type": "geneprod",
"uniprot_ids": [
"P50211"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "395483",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "395483",
"original_type": "gene",
"role": "intervention",
"text": "Sox8",
"type": "geneprod",
"uniprot_ids": [
"P57074",
"F1P1Z5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "395483",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "395483",
"original_type": "gene",
"role": "intervention",
"text": "Sox8",
"type": "geneprod",
"uniprot_ids": [
"P57074",
"F1P1Z5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "395483",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "395483",
"original_type": "gene",
"role": "intervention",
"text": "Sox8",
"type": "geneprod",
"uniprot_ids": [
"P57074",
"F1P1Z5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "395483",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "395483",
"original_type": "gene",
"role": "intervention",
"text": "SOX8",
"type": "geneprod",
"uniprot_ids": [
"P57074",
"F1P1Z5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9W757",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX10",
"type": "geneprod",
"uniprot_ids": [
"Q9W757"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9PU40",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TH",
"type": "geneprod",
"uniprot_ids": [
"Q9PU40"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9PU40",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TH",
"type": "geneprod",
"uniprot_ids": [
"Q9PU40"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9PU40",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TH",
"type": "geneprod",
"uniprot_ids": [
"Q9PU40"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9PU40",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TH",
"type": "geneprod",
"uniprot_ids": [
"Q9PU40"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9PU40",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TH",
"type": "geneprod",
"uniprot_ids": [
"Q9PU40"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9PU40",
"ext_tax_ids": "9031",
"ext_tax_names": "Gallus gallus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TH",
"type": "geneprod",
"uniprot_ids": [
"Q9PU40"
]
}
] |
||
10.15252/embr.201847047
|
Cerebrovascular endothelial cells form transient Notch-dependent cystic structures in zebrafish
|
2019
|
Figure 3
|
<sd-panel> <p><strong>Figure 3| Endothelial <em>kugeln</em> are non-nucleated with a filamenteous actin-enriched neck.</strong></p> <p><strong>A</strong> Double transgenic visualizing endothelial <sd-pretag id="sdPretag182334032sm" type="subcellular" role="component">membrane</sd-pretag> (red) and endothelial <sd-pretag id="sdPretag1981255440sm" type="subcellular" role="component">nuclei</sd-pretag> (green). Endothelial <sd-pretag id="sdPretag1075494765sm" type="subcellular" role="component">nuclei</sd-pretag> (arrowhead) were observed close to but never within the <em>kugel</em> (unfilled arrowhead).</p> <p><strong>B</strong> Double transgenic showing endothelial <sd-pretag id="sdPretag1351041525sm" type="subcellular" role="component">membrane</sd-pretag> (red) and endothelial F-<sd-pretag id="sdPretag382303037sm" type="geneprod" role="assayed">actin</sd-pretag> (green). F-<sd-pretag id="sdPretag717349829sm" type="geneprod" role="assayed">actin</sd-pretag> was found to localize at the neck of the <em>kugeln</em> (arrowhead; see also: <strong>EV Movie3</strong>).</p> <p><strong>C</strong> Double transgenic showing endothelial <sd-pretag id="sdPretag1943394691sm" type="subcellular" role="component">membrane</sd-pretag> (red) and <sd-pretag id="sdPretag231959903sm" type="cell" role="component">endothelial</sd-pretag> <sd-pretag id="sdPretag495852990sm" type="subcellular" role="component">cytoplasm</sd-pretag> (green). The <sd-pretag id="sdPretag454907086sm" type="subcellular" role="component">cytoplasmic</sd-pretag> reporter was visible in the parent vessel but not in the <em>kugel</em> (unfilled arrowhead).</p> <p><strong>D</strong> Triple transgenic showing <sd-pretag id="sdPretag2041611022sm" type="cell" role="component">endothelial</sd-pretag> <sd-pretag id="sdPretag1168416082sm" type="subcellular" role="component">membrane</sd-pretag> (red), <sd-pretag id="sdPretag258481111sm" type="cell" role="component">neurons</sd-pretag> (green) and <sd-pretag id="sdPretag528181680sm" type="cell" role="component">erythrocytes</sd-pretag> (red). Surrounding <sd-pretag id="sdPretag1541268176sm" type="cell" role="component">neurons</sd-pretag> were excluded from the volume of the <em>kugel</em> (unfilled arrowhead) and <sd-pretag id="sdPretag926673053sm" type="cell" role="component">erythrocytes</sd-pretag> were not observed inside <em>kugeln</em> (arrowhead).</p> <p><strong>E</strong> Treatment with the inhibitor of <sd-pretag id="sdPretag1344245012sm" type="geneprod" role="assayed">actin</sd-pretag> polymerization Latrunculin B <em>statistically significantly increased number of kugeln per <sd-pretag id="sdPretag1620501234sm" type="organism" role="component">embryo</sd-pretag> (100nM 1 hour; **p = 0.0041; control n=21 <sd-pretag id="sdPretag1129246070sm" type="organism" role="component">embryos</sd-pretag> 8.05</em> ± <em>1.76 (</em>mean ± s.e.m.)<em>; Latrunculin n=21 <sd-pretag id="sdPretag1144229031sm" type="organism" role="component">embryos</sd-pretag> 17.19</em> ± <em>2.93 (</em>mean ± s.e.m.)<em>; 4dpf; 3 experimental repeats; Mann-Whitney U test).</em></p> <p><strong>F</strong> Latrunculin B treatment statistically significantly reduced <em>kugel diameter (*p = 0.0164; control n=169 kugeln from 21 <sd-pretag id="sdPretag932070086sm" type="organism" role="component">embryos</sd-pretag> 7.56</em> ± 2.25 <em>(</em>mean ± s.e.m.)<em>; Latrunculin n=361 kugeln from 21 <sd-pretag id="sdPretag1226332330sm" type="organism" role="component">embryos</sd-pretag> 5.91</em> ± <em>1.78 (</em>mean ± s.e.m.)<em>; 4dpf; 3 experimental <sd-pretag id="sdPretag2060175787sm" type="tissue" role="component">repeats</sd-pretag>; Student's t-test).</em></p> <p><em><strong>G</strong></em> Treatment with the <sd-pretag id="sdPretag1408831039sm" type="geneprod" role="intervention">Myosin</sd-pretag> II inhibitor <sd-pretag id="sdPretag245127965sm" type="molecule" role="intervention">Blebbistatin</sd-pretag> statistically significantly reduced n<em>umber of kugeln per <sd-pretag id="sdPretag38195789sm" type="organism" role="component">embryo</sd-pretag></em> (25 µM 1h; ****p <0.0001; control n=22 <sd-pretag id="sdPretag1166483484sm" type="organism" role="component">embryos</sd-pretag> 3.77 ± <em>0.56 (</em>mean ± s.e.m.), Blebbistatin n=24 <sd-pretag id="sdPretag1328342914sm" type="organism" role="component">embryos</sd-pretag> 1.08 ± <em>0.22 (</em>mean ± s.e.m.); 3dpf; 3 experimental repeats; <em>Mann-Whitney U test</em>).</p> <p><em><strong>H</strong> <sd-pretag id="sdPretag997549931sm" type="molecule" role="intervention">Blebbistatin</sd-pretag> treatment had no effect on kugel diameter (p = 0.3731; control n=83 kugeln from 22 <sd-pretag id="sdPretag520253360sm" type="organism" role="component">embryos</sd-pretag> 6.27</em> ± 0.72 <em>(</em>mean ± s.e.m.)<em>, Blebbistatin n=26 kugeln from 24 <sd-pretag id="sdPretag1079092039sm" type="organism" role="component">embryos</sd-pretag> 7.02</em> ± 0.89 <em>(</em>mean ± s.e.m.)<em>; 3dpf; 3 experimental repeats; Mann-Whitney U test).</em></p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=25968
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q7ZVI7",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "F-actin",
"type": "geneprod",
"uniprot_ids": [
"Q7ZVI7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q7ZVI7",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "F-actin",
"type": "geneprod",
"uniprot_ids": [
"Q7ZVI7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "A5D6S9",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "Myosin II",
"type": "geneprod",
"uniprot_ids": [
"A5D6S9"
]
}
] |
||
10.15252/embr.201847047
|
Cerebrovascular endothelial cells form transient Notch-dependent cystic structures in zebrafish
|
2019
|
Figure 4
|
<sd-panel> <p><strong>Figure 4 | The relationship between endothelial kugeln and <sd-pretag id="sdPretag1480722133sm" type="tissue" role="component">blood</sd-pretag> flow</strong></p> <p><strong>A</strong> MIP of the <sd-pretag id="sdPretag541240313sm" type="tissue" role="component">cerebral vessels</sd-pretag> of a 4dpf <sd-pretag id="sdPretag768987428sm" type="organism" role="component">embryo</sd-pretag> before exsanguination (grey LUT; inverted).</p> <p><strong>B</strong> MIP of the same <sd-pretag id="sdPretag1013391625sm" type="organism" role="component">embryo</sd-pretag> after exsanguination, which did not alter <em>kugel</em> size.</p> <p><strong>C</strong> <sd-pretag id="sdPretag1972306122sm" category="assay">Time</sd-pretag>-<sd-pretag id="sdPretag1426664522sm" category="assay">lapse imaging</sd-pretag> of an <sd-pretag id="sdPretag552993101sm" type="organism" role="component">embryo</sd-pretag> with transiently halted cardiac contraction (using Tricaine). Despite absent <sd-pretag id="sdPretag1992038397sm" type="tissue" role="component">blood</sd-pretag> flow <em>kugeln</em> still changed shape (grey arrowhead), retained shape (white arrowhead) or protruded and retracted (black arrowhead; time post cessation of flow is indicated on micrographs; 3dpf; grey inverted <sd-pretag id="sdPretag1615957511sm" type="molecule" role="component">LUT</sd-pretag>).</p> <p><strong>D</strong> <sd-pretag id="sdPretag192164595sm" category="assay">Time</sd-pretag>-<sd-pretag id="sdPretag1294344475sm" category="assay">lapse</sd-pretag> of an <sd-pretag id="sdPretag945788310sm" type="organism" role="component">embryo</sd-pretag> with transiently halted cardiac contraction as in (C) showed that <em>kugel</em> diameter still oscillates (time post cessation of flow).</p> <p><strong>E</strong> <sd-pretag id="sdPretag1925702679sm" category="assay">Dextran microangiography</sd-pretag> filled perfused <sd-pretag id="sdPretag1979972814sm" type="tissue" role="component">vessels</sd-pretag> with <sd-pretag id="sdPretag874459737sm" type="molecule" role="component">dextran</sd-pretag> (arrowhead), while dextran was not observed to enter <em>kugeln</em> (unfilled arrowhead).</p> <p><strong>F</strong> Inhibition of <sd-pretag id="sdPretag991248361sm" type="tissue" role="component">cardiac</sd-pretag> contraction by <em>tnnt2a</em> morpholino (MO) knockdown statistically significantly reduced <em>kugel</em> number per <sd-pretag id="sdPretag13795800sm" type="organism" role="component">embryo</sd-pretag> (****p<0.0001; control n=20 <sd-pretag id="sdPretag1410426001sm" type="organism" role="component">embryos</sd-pretag> 5.10 ± <em>1.47 (</em>mean ± s.e.m.), <em>tnnt2a</em> MO=18 <sd-pretag id="sdPretag1573290748sm" type="organism" role="component">embryos</sd-pretag> 0.06 ± <em>0.06 (</em>mean ± s.e.m.); 3dpf; 3 experimental repeats; <em>Mann-Whitney U test</em>).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=25970
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "58071",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "58071",
"original_type": "gene",
"role": "intervention",
"text": "tnnt2a",
"type": "geneprod",
"uniprot_ids": [
"Q90Y46"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "58071",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "58071",
"original_type": "gene",
"role": "intervention",
"text": "tnnt2a",
"type": "geneprod",
"uniprot_ids": [
"Q90Y46"
]
}
] |
||
10.15252/embr.201847047
|
Cerebrovascular endothelial cells form transient Notch-dependent cystic structures in zebrafish
|
2019
|
Figure 5
|
<sd-panel> <p><strong>Figure 5| <sd-pretag id="sdPretag89594574sm" type="geneprod" role="component"><em>Kugeln</em></sd-pretag> do not interact with <sd-pretag id="sdPretag1379500191sm" type="tissue" role="component">brain lymphatic</sd-pretag> <sd-pretag id="sdPretag189599298sm" type="cell" role="component">endothelial cells</sd-pretag> (<sd-pretag id="sdPretag1985829983sm" type="cell" role="component">BLECs</sd-pretag>) in <em>Tg(<sd-pretag id="sdPretag1182886477sm" type="geneprod" role="intervention">fli1a</sd-pretag>:LifeAct-mClover)<sup>sh467</sup></em>, <em>Tg(<sd-pretag id="sdPretag1940593614sm" type="geneprod" role="component">kdrl</sd-pretag>:<sd-pretag id="sdPretag1038767693sm" type="geneprod" role="component">HRAS</sd-pretag>-<sd-pretag id="sdPretag1692768864sm" type="geneprod" role="reporter">mCherry</sd-pretag>)<sup>s916</sup></em>, nor do they take up injected IgG-conjugated Alexa 674.</strong></p> <p><strong>A</strong> <em>Kugeln</em> were studied in the double-transgenic <em>Tg(<sd-pretag id="sdPretag59836222sm" type="geneprod" role="component">fli1a</sd-pretag>:<sd-pretag id="sdPretag592906154sm" type="geneprod" role="reporter">LifeAct</sd-pretag>-mClover)<sup>sh467</sup></em>, <em>Tg(<sd-pretag id="sdPretag1062465490sm" type="geneprod" role="assayed">kdrl</sd-pretag>:<sd-pretag id="sdPretag429183942sm" type="geneprod" role="assayed">HRAS</sd-pretag>-<sd-pretag id="sdPretag1348546524sm" type="geneprod" role="reporter">mCherry</sd-pretag>)<sup>s916</sup>.</em></p> <p><strong>B</strong> <sd-pretag id="sdPretag2060960372sm" type="cell" role="component">BLECs</sd-pretag> were mClover positive and <sd-pretag id="sdPretag544267967sm" type="geneprod" role="reporter">mCherry</sd-pretag>-negative (<sd-pretag id="sdPretag1814863474sm" type="cell" role="component">BLECs</sd-pretag> - black arrowheads; <em>kugeln</em> - white arrowheads).</p> <p><strong>C</strong> No direct physical interaction between <em>kugeln</em> (<sd-pretag id="sdPretag617920281sm" type="cell" role="component">BLECs</sd-pretag> - black arrowheads; <em>kugeln</em> - white arrowheads) and <sd-pretag id="sdPretag1274572631sm" type="cell" role="component">BLECs</sd-pretag> was observed (n=21 4dpf <sd-pretag id="sdPretag766765807sm" type="organism" role="component">embryos</sd-pretag>; 3 experimental repeats).</p> <p><strong>D</strong> Depth-coded MIPs showed that <sd-pretag id="sdPretag1162369051sm" type="cell" role="component">BLECs</sd-pretag> and <em>kugeln</em> are present on different anatomical planes (depths; purple ventral (v), white dorsal (d); <sd-pretag id="sdPretag1454697468sm" type="cell" role="component">BLECs</sd-pretag> - black arrowheads; <em>kugeln</em> - white arrowheads).</p> <p><strong>E</strong> <sd-pretag id="sdPretag166006700sm" type="geneprod" role="intervention"><em>Ccbe1</em></sd-pretag> morpholino (MO) injection led to a loss of <sd-pretag id="sdPretag329557811sm" type="tissue" role="component">lymphatics</sd-pretag> (white arrowhead).</p> <p><strong>F</strong> <em>Kugel</em> number was not statistically significantly altered by <sd-pretag id="sdPretag1936713679sm" type="geneprod" role="intervention"><em>ccbe1</em></sd-pretag> morpholino (MO) knockdown (p = 0.3496; control MO n=22 <sd-pretag id="sdPretag1234462706sm" type="organism" role="component">embryos</sd-pretag> 0.95 ± 0.28 (mean ± s.e.m.), <em>ccbe1</em> MO n=23 <sd-pretag id="sdPretag2037043073sm" type="organism" role="component">embryos</sd-pretag> 0.57 ± 0.14 (mean ± s.e.m.); 3dpf; 3 experimental repeats; Mann-Whitney U test).</p> <p><strong>G</strong> <em>Kugel</em> diameter was not statistically significantly altered by <sd-pretag id="sdPretag1323897890sm" type="geneprod" role="intervention"><em>ccbe1</em></sd-pretag> MO knockdown (p = 0.8783; control MO n=21 <em>kugeln</em> from 22 <sd-pretag id="sdPretag1345937722sm" type="organism" role="component">embryos</sd-pretag> 7.75 ± 1.29 (mean ± s.e.m.), <em>ccbe1</em> MO n=13 <em>kugeln</em> from <sd-pretag id="sdPretag1814373041sm" type="organism" role="component">23 embryos</sd-pretag> 8.93 ± 2.35 (mean ± s.e.m.); 3dpf; 3 experimental repeats; Mann-Whitney U test).</p> <p><strong>H</strong> Injection of IgG-conjugated Alexa 647 into the <sd-pretag id="sdPretag1081107394sm" type="tissue" role="component">tectum</sd-pretag> showed no uptake (blue; unfilled arrowhead) by <em>kugeln</em> (white arrowhead; 140 <em>kugeln</em> from 17 4dpf <sd-pretag id="sdPretag1733591859sm" type="organism" role="component">embryos</sd-pretag>; 2 experimental repeats).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=25972
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "555629",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "555629",
"original_type": "gene",
"role": "intervention",
"text": "Ccbe1",
"type": "geneprod",
"uniprot_ids": [
"A8WGB1",
"A0A8M6YWX1"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "555629",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "555629",
"original_type": "gene",
"role": "intervention",
"text": "ccbe1",
"type": "geneprod",
"uniprot_ids": [
"A8WGB1",
"A0A8M6YWX1"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "555629",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "555629",
"original_type": "gene",
"role": "intervention",
"text": "ccbe1",
"type": "geneprod",
"uniprot_ids": [
"A8WGB1",
"A0A8M6YWX1"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "555629",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "555629",
"original_type": "gene",
"role": "intervention",
"text": "ccbe1",
"type": "geneprod",
"uniprot_ids": [
"A8WGB1",
"A0A8M6YWX1"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "555629",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "555629",
"original_type": "gene",
"role": "intervention",
"text": "ccbe1",
"type": "geneprod",
"uniprot_ids": [
"A8WGB1",
"A0A8M6YWX1"
]
}
] |
||
10.15252/embr.201847047
|
Cerebrovascular endothelial cells form transient Notch-dependent cystic structures in zebrafish
|
2019
|
Figure 7
|
<sd-panel> <p><strong>Figure 7| <em>Kugel</em> number is increased by VEGF inhibition, and <em>kugeln</em> contain NO.</strong></p> <p><strong>A</strong> VEGF inhibition by 2h treatment with AV951 statistically significantly increased <em>kugel</em> number (****p<0.0001; DMSO control n=30 embryos 8.53 ± 2.62 (mean ± s.e.m.); AV951 n=31 embryos 21.10 ± 2.71 (mean ± s.e.m.); 4dpf; 4 experimental repeats; Mann-Whitney U test).</p> <p><strong>B</strong> Mean <em>kugel</em> diameter was not statistically significantly different after AV951 treatment (p = 0.7890; DMSO control n=243 <em>kugeln</em> from 30 embryos 9.94 ± 0.76 (mean ± s.e.m.); AV951 n=652 <em>kugeln</em> from 31 embryos 9.73 ± 0.32 (mean ± s.e.m.); 4dpf; 4 experimental repeats; Student's t-test).</p> <p><strong>C</strong> DAF-FM staining, a vital dye for nitric oxide (NO), showed that 57.56% of <em>kugeln</em> were positive for nitric oxide reactivity (2.5µM incubation from 96-102hpf; n=22 4dpf embryos; 118 of 205 <em>kugeln</em> filled; 3 experimental repeats). Images show representative "filled" (DAF-FM positive) and "unfilled" (DAF-FM negative) <em>kugeln</em>.</p> <p><strong>D</strong> Time-lapse acquisition with DAF-FM revealed that <em>kugeln</em> contained NO early in their biogenesis (grey LUT; inverted).</p> <p><strong>E</strong> Application of LysoTracker, a vital dye that stains lysosomes or acidic compartments, showed that 17.08% of <em>kugeln</em> contained acidic contents (8.33µM; 96-101hpf; n=22 4dpf embryos; 62 of 363 <em>kugeln</em> filled; 3 experimental repeats). Images show representative "filled" (Lysotracker positive) and "unfilled" (Lysotracker negative) <em>kugeln</em>.</p> <p><strong>F</strong> The nitric oxide synthase (NOS) inhibitor L-NAME had no statistically significant effect on <em>kugel</em> number per embryo (0.5mM L-NAME 18h; p = 0.4870; control n=22 embryos 14.27 ± 3.35 (mean ± s.e.m.), L-NAME n=24 embryos 7.46 ± 1.61 (mean ± s.e.m.); 4dpf; 3 experimental repeats; Mann-Whitney U test).</p> <p><strong>G</strong> Diameter of <em>kugeln</em> was not affected by L-NAME (p = 0.4161; control n=315 <em>kugeln</em> from 22 embryos 8.77 ± 0.49 (mean ± s.e.m.), L-NAME n=179 <em>kugeln</em> from 24 8.66 ± 0.71 (mean ± s.e.m.); 4dpf; 3 experimental repeats; Mann-Whitney U test).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=25974
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8AXB3",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "VEGF",
"type": "geneprod",
"uniprot_ids": [
"Q8AXB3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q800V0",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "nitric oxide synthase",
"type": "geneprod",
"uniprot_ids": [
"Q800V0"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q800V0",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "NOS",
"type": "geneprod",
"uniprot_ids": [
"Q800V0"
]
}
] |
||
10.15252/embr.201847047
|
Cerebrovascular endothelial cells form transient Notch-dependent cystic structures in zebrafish
|
2019
|
Figure 8
|
<sd-panel> <p><strong>Figure 8| <em>Kugel</em> number is decreased by Notch inhibition but increased by Wnt inhibition or activation.</strong></p> <p><strong>A</strong> <em>Kugel</em> number was significantly decreased by inhibition of Notch signalling by 12h treatment with 50µM DAPT (****p<0.0001; control n=24 embryos 9.38 ± 1.77 (mean ± s.e.m.), DAPT n=24 embryos 0.92 ± 0.28 (mean ± s.e.m.); 4dpf; 3 experimental repeats; Mann-Whitney U test).</p> <p><strong>B</strong> Mean <em>kugel</em> diameter was not statistically significantly altered by DAPT treatment (p = 0.0832; control n=225 <em>kugeln</em> from 24 embryos 8.64 ± 0.54 (mean ± s.e.m.); DAPT n=22 <em>kugeln</em> from 24 embryos 6.88 ± 0.86 (mean ± s.e.m.); 4dpf; 3 experimental repeats; Student's t-test).</p> <p><strong>C</strong> A transgenic <em>dll4</em> reporter line showed no indication of different <em>dll4</em> expression at the sites of <em>kugeln</em> (white arrowheads pointing to <em>kugeln</em>; n=122 <em>kugeln</em> from 23 3dpf embryos; 2 experimental repeats).</p> <p><strong>D</strong> Studying Notch signalling in the Notch reporter line <em>Tg(TP1glob:venusPest)<sup>s940</sup></em>, showed high Notch levels in the mid-brain, but, again, no difference in expression at the sites of <em>kugeln</em> (n=45 <em>kugeln</em> from 19 4dpf embryos; 2 experimental repeats).</p> <p><strong>E</strong> <em>Kugel</em> number was statistically significantly increased by inhibition of Wnt signalling by 4h treatment with 10µm XAV-939 (***p = 0.0003; control n=22 embryos 1.32 ± 0.24 (mean ± s.e.m.); XAV-939 n=21 embryos 4.29 ± 0.71 (mean ± s.e.m.); 3dpf; 3 experimental repeats; Mann-Whitney U test).</p> <p><strong>F</strong> <em>Kugel</em> diameter was not statistically significantly altered by XAV-939 (p = 0.4098; control n=29 <em>kugeln</em> from 22 embryos 8.78 ± 0.76 (mean ± s.e.m.); XAV-939 n=90 <em>kugeln</em> from 21 embryos 7.99 ± 0.56 (mean ± s.e.m.); 3dpf; 3 experimental repeats; Student's t-test)</p> <p><strong>G</strong> <em>Kugel</em> number was statistically significantly increased by activation of Wnt signalling by 4h treatment with 10µm GSK3 inhibition XV (p 0.0359; control n=22 embryos 1.04 ± 0.34 (mean ± s.e.m.); GSK3 inhibitor n=21 embryos 4.24 ± 1.28 (mean ± s.e.m.); 3dpf; 3 experimental repeats; Mann-Whitney U test).</p> <p><strong>H</strong> The diameter of <em>kugel</em> was not statistically significantly altered by GSK3 inhibition (p 0.5555; control n=23 <em>kugeln</em> from 22 embryos 7.26 ± 0.89 (mean ± s.e.m.); GSK3 inhibitor n=89 <em>kugeln</em> from 21 embryos 8.09 ± 0.97 (mean ± s.e.m.); 3dpf; 3 experimental repeats; Student's t-test).</p> <p><strong><br></strong></p> <p><strong>Expanded View Figure Legends</strong></p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=25975
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P46530",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "Notch",
"type": "geneprod",
"uniprot_ids": [
"P46530"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q5SPB5",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "dll4",
"type": "geneprod",
"uniprot_ids": [
"Q5SPB5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P46530",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Notch",
"type": "geneprod",
"uniprot_ids": [
"P46530"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P46530",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Notch",
"type": "geneprod",
"uniprot_ids": [
"P46530"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P46530",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Notch",
"type": "geneprod",
"uniprot_ids": [
"P46530"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot///Uniprot///Uniprot///Uniprot",
"ext_ids": "Q92050///P51028///P51029///O73864///P47793///P24257",
"ext_tax_ids": "7955///7955///7955///7955///7955///7955",
"ext_tax_names": "Danio rerio///Danio rerio///Danio rerio///Danio rerio///Danio rerio///Danio rerio",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "Wnt",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9YH60",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "GSK3",
"type": "geneprod",
"uniprot_ids": [
"Q9YH60"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9YH60",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "GSK3",
"type": "geneprod",
"uniprot_ids": [
"Q9YH60"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9YH60",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "GSK3",
"type": "geneprod",
"uniprot_ids": [
"Q9YH60"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9YH60",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "GSK3",
"type": "geneprod",
"uniprot_ids": [
"Q9YH60"
]
}
] |
||
10.15252/emmm.201910419
|
Ribonucleotide reductase inhibitors suppress SAMHD1 ara-CTPase activity enhancing ara-C efficacy
|
2019
|
Figure 1
|
<sd-panel> <p><strong>Figure 1 | RNR inhibitor and ara-C synergy is dependent upon functional SAMHD1 in cancer cell models.</strong></p> <ol type="A"> <li> <p>Schematic detailing proposed interplay between RNR and SAMHD1.</p> </li> <li> <p>Immunoblot of lysates prepared from the indicated SAMHD1-proficient (<sup>+/+</sup>), deficient (<sup>-/-</sup>) and rescue (WT, H233A) cell line pairs with the indicated antibodies. Representative of 2 independent experiments.</p> </li> <li> <p>Proliferation inhibition analysis of ara-C and RNRi combination treatment in SAMHD1<sup>+/+</sup> or <sup>-/-</sup> THP-1 cells. Error bars indicate s.e.m. of two (HU and dF-dC) or three (3-AP) independent experiments, each performed in duplicate.</p> </li> <li> <p>Ara-C EC<sub>50</sub> values plotted as a function of RNRi concentration in SAMHD1<sup>+/+</sup>, <sup>-/-</sup> and rescue (WT, H233A) THP-1 cell line pairs. EC<sub>50</sub> values in the absence of RNRi are indicated by the black and red dotted line. Error bars indicate s.e.m. of two (HU and dF-dC) or three (3-AP) independent experiments, each performed in duplicate.</p> </li> <li> <p>Drug synergy plots for ara-C and the indicated RNRi in SAMHD1<sup>+/+</sup>, <sup>-/-</sup> and rescue (WT, H233A) cell line pairs. Each data point indicates an average delta score from a single dose-response matrix experiment performed in duplicate. Zero, >0, or <0 corresponds to additive, synergy, or antagonism, respectively, whilst >5 indicates strong synergy. The horizontal line and the error bars indicate the mean and s.d., respectively, statistical significance was determined using a two-tailed unpaired <em>t-</em>test: ns, not significant, <em>P</em> ≥ 0.05; *, <em>P</em> < 0.05; **, <em>P</em> < 0.01; ***, <em>P</em> < 0.001; ****, <em>P</em> < 0.0001.</p> </li> <li> <p>Spearman correlation of relative SAMHD1 protein abundance and synergy delta scores for ara-C versus HU or dF-dC in a panel (<em>n</em> = 9) of haematological cancer cell lines. Error bars indicate s.e.m. Each data point corresponds to SAMHD1 protein levels determined by immunoblot analysis (<em>n</em> = 4 for each cell line, representative blot shown in <strong>Appendix Fig S2</strong>) and an average delta score from repeated dose-response matrix experiments each performed in triplicate: THP-1, <em>n</em> =4; HuT-78, <em>n</em> = 2; HL-60/iva, <em>n</em> = 1; KBM-7, <em>n</em> = 2 (HU) and 3 (dF-dC); K562, <em>n</em> = 3 (HU) and 4 (dF-dC); CCRF-CEM, <em>n</em> =3 (HU) and 4 (dF-dC); MV-4-11, <em>n</em> = 2 (HU) and 3 (dF-dC); Jurkat, <em>n</em> = 2 (HU) and 3 (dF-dC); MOLT-4, <em>n</em> = 2 (HU) an 3 (dF-dC).</p> </li> <li> <p>Immunoblot analysis of lysates prepared from SAMHD1<sup>+/+</sup> or <sup>-/-</sup> THP-1 cells treated for 24 h with ara-C and HU, as indicated. Representative of 3 independent experiments.</p> </li> </ol> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=29606
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "25939",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "25939",
"original_type": "gene",
"role": "intervention",
"text": "SAMHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y3Z3",
"A0A2R8YCS7",
"Q59H15"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "25939",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "25939",
"original_type": "gene",
"role": "intervention",
"text": "SAMHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y3Z3",
"A0A2R8YCS7",
"Q59H15"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P23921///P31350///Q7LG56",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "RNR",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "25939",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "25939",
"original_type": "gene",
"role": "intervention",
"text": "SAMHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y3Z3",
"A0A2R8YCS7",
"Q59H15"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P23921///P31350///Q7LG56",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "RNR",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P23921///P31350///Q7LG56",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "RNR",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "25939",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "25939",
"original_type": "gene",
"role": "intervention",
"text": "SAMHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y3Z3",
"A0A2R8YCS7",
"Q59H15"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y3Z3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SAMHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y3Z3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y3Z3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SAMHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y3Z3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "25939",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "25939",
"original_type": "gene",
"role": "intervention",
"text": "SAMHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y3Z3",
"A0A2R8YCS7",
"Q59H15"
]
}
] |
||
10.15252/emmm.201910419
|
Ribonucleotide reductase inhibitors suppress SAMHD1 ara-CTPase activity enhancing ara-C efficacy
|
2019
|
Figure 2
|
<sd-panel> <p><strong>Figure 2 | RNR inhibition overcomes the SAMHD1-mediated barrier to ara-C in AML mouse models</strong></p> <ol type="A"> <li> <p>Kaplan-Meier analysis of NOD/SCID mice injected i.v. with luciferase-expressing SAMHD1<sup>+/+</sup> or <sup>-/-</sup> THP-1 cell clones (day 0) and treated with ara-C and/or HU as indicated (day 6). <em>n</em> = 6 per treatment group. For further data and analysis see <strong>Appendix Fig S6</strong>.</p> </li> <li> <p>Kaplan-Meier analysis of NOD/SCID mice injected i.v. with luciferase-expressing SAMHD1<sup>+/+</sup> or <sup>-/-</sup> HL-60/iva cell clones (day 0) and treated with ara-C and/or HU as indicated (day 6). <em>n</em> = 6 per treatment group. For further data and analysis see <strong>Appendix Fig S7</strong>.</p> </li> <li> <p>Kaplan-Meier analysis of NOD/SCID mice injected i.v. with luciferase-expressing SAMHD1<sup>+/+</sup> THP-1 cell clone (day 0) and treated with ara-C and/or dF-dC as indicated (day 6). <em>n</em> = 7 per treatment group. For further data and analysis see <strong>Appendix Fig S8</strong>.</p> </li> <li> <p>Kaplan-Meier analysis of CD45.2 C57BL/6J mice injected i.v. with murine MLL-AF9-transformed AML blasts (day 0) and treated with ara-C and/or HU days 20-24. <em>n</em> = 5 per treatment group, except for vehicle (<em>n</em> = 4). For further data and analysis see <strong>Appendix Fig S8 and Appendix Fig S9</strong>.</p> </li> </ol> <p><strong>Data information:</strong> Tick marks indicate censored animals. Statistical significance determined using Mantel-Cox log-rank test: ns, not significant, <em>P</em> ≥ 0.05; *, <em>P</em> < 0.05; **, <em>P</em> < 0.01.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=29610
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "25939",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "25939",
"original_type": "gene",
"role": "intervention",
"text": "SAMHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y3Z3",
"A0A2R8YCS7",
"Q59H15"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "25939",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "25939",
"original_type": "gene",
"role": "intervention",
"text": "SAMHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y3Z3",
"A0A2R8YCS7",
"Q59H15"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "214162",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "unmapped",
"mapping_status": "unmapped",
"ncbi_gene_id": "214162",
"original_type": "gene",
"role": "assayed",
"text": "MLL-AF9",
"type": "geneprod",
"uniprot_ids": []
}
] |
||
10.15252/emmm.201910419
|
Ribonucleotide reductase inhibitors suppress SAMHD1 ara-CTPase activity enhancing ara-C efficacy
|
2019
|
Figure 3
|
<sd-panel> <p><strong>Figure 3 | Figure 3 | RNR inhibition enhances ara-C efficacy in primary patient AML blasts in a SAMHD1-dependant manner</strong></p> <ol type="A"> <li> <p>Drug synergy plots for ara-C and HU or dF-dC in primary patient-derived AML blasts. Each data point indicates an average delta score from a single patient sample subjected to a dose-response matrix experiment performed in triplicate, <em>n</em> = 16 for HU and <em>n</em> = 9 for dF-dC. Zero, >0, or <0 corresponds to additive, synergy, or antagonism, respectively, whilst >5 indicates strong synergy. Median, upper and lower quartiles, and range of delta scores are indicated by box-and-whisker plots. For proliferation inhibition curves for each sample see <strong>Appendix Fig S10A</strong> and <strong>B</strong>, and for patient characteristics see <strong>Appendix Table S2</strong>.</p> </li> <li> <p>Pearson correlation of relative SAMHD1 protein abundance and synergy delta scores for ara-C and HU or dF-dC in primary patient-derived AML blasts (<em>n</em> = 23). For immunoblot analysis of SAMHD1 protein abundance see <strong>Appendix Fig S10C</strong>.</p> </li> </ol> <ol start="3"> <li> <p>Immunoblot of primary patient-derived AML blasts treated with control (dX) or Vpx-containing (X) virus-like particles (VLPs): patient A2953 (C), ALG17_001 (E). Accompanying proliferation inhibition analysis of ara-C and indicated RNRi combination in these samples: patient A2953 (D), ALG17_001 (D). Error bars indicate s.d. of single experiment performed in triplicate.</p> </li> </ol> <ol start="7"> <li> <p>Paired drug synergy plot for ara-C and RNRi (HU, <em>n</em> = 7; dF-dC, <em>n</em> = 5) in primary patient-derived AML blasts pre-treated with control (dX) or Vpx-containing (X) VLPs. Zero, >0, or <0 corresponds to additive, synergy, or antagonism, respectively, whilst >5 indicates strong synergy and <5 indicates strong antagonism. Each data point indicates an average delta score from a single patient sample subjected to a dose-response matrix experiment performed in triplicate. Statistical testing was performed using two-way ANOVA.</p> </li> </ol> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=29614
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y3Z3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SAMHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y3Z3"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q7LG56///P23921///P31350",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "RNR",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q7ZB17",
"ext_tax_ids": "11723",
"ext_tax_names": "Simian immunodeficiency virus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "Vpx",
"type": "geneprod",
"uniprot_ids": [
"Q7ZB17"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q7ZB17",
"ext_tax_ids": "11723",
"ext_tax_names": "Simian immunodeficiency virus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "Vpx",
"type": "geneprod",
"uniprot_ids": [
"Q7ZB17"
]
}
] |
||
10.15252/emmm.201910419
|
Ribonucleotide reductase inhibitors suppress SAMHD1 ara-CTPase activity enhancing ara-C efficacy
|
2019
|
Figure 4
|
<sd-panel> <p><strong>Figure 4 | dCTPαS-activated SAMHD1 is a poor ara-CTPase</strong></p> <ol type="A"> <li> <p>Intracellular dNTP measurements using a primer-extension assay in SAMHD1<sup>+/+</sup> THP-1 cells treated for 4 or 24 h with either 50 µM HU (middle panel) or 2.5 nM 3-AP (right panel), ratios of dCTP-to-dATP were calculated. Bars indicate mean values of three independent experiments, error bars indicate s.e.m. Statistical analyses were done using unpaired two-tailed <em>t</em>-tests: **, <em>P</em> < 0.01. For absolute values of dNTP pool measurements, see <strong>Appendix Fig S11</strong>.</p> </li> <li> <p>Intracellular ara-CTP (upper panel) and dCTP:dATP ratio (lower panel) in the indicated cell lines following the indicated treatment determined using HPLC-MS/MS. SAMHD1<sup>-/-</sup> THP-1 cells were treated with 500 nM ara-C and SAMHD1<sup>+/+</sup> THP-1 cells were treated with either solvent, 500 nM ara-C or a combination of 500 nM ara-C and an RNRi (HU, 50 µM; dF-dC, 10 nM; 3-AP, 150 nM) for 24 h prior. Values relative to mean ara-CTP amounts in ara-C treated SAMHD1<sup>+/+</sup> THP-1 cells shown (indicated by dashed line). Circles, columns and error bars correspond to individual values, means and s.e.m. of at least three experiments performed independently. Analyses were performed using unpaired two-tailed <em>t</em>-tests. *, <em>P</em> < 0.05; **, <em>P</em> < 0.01.</p> </li> <li> <p>Quantificaiton of dCK phosphorylation at serine-74 (S74) with respect to total dCK in SAMHD1<sup>+/+</sup> THP-1 cells treated with either solvent, 500 nM ara-C or a combination of 500 nM ara-C and an RNRi (HU, 50 µM; dF-dC, 10 nM; 3-AP, 150 nM) for 24 h. Circles and squares, columns and error bars correspond to individual measurements, means and s.e.m. of one representative out of two independent experiments performed in triplicates. Statistical analyses were performed using unpaired two-tailed <em>t</em>-test. *, <em>P</em> < 0.05; **, <em>P</em> < 0.01.</p> </li> <li> <p>Measurement of released inorganic triphosphate (PPPi) from hydrolysis of ara-CTP (200 µM) by recombinant SAMHD1 (0.35 µM) in the presence of GTP (200 µM) and a titration of different non-hydrolysable dNTP analogues (dNTPαS) in the enzyme-coupled malachite green assay. Error bars indicate s.e.m. of two independent experiments performed in triplicate and quadruplet.</p> </li> </ol> <p><strong>Tables and their legends</strong></p> <p><strong>Table 1 |</strong> Hazards ratios (HR) for mRNA levels of <em>SAMHD1</em> and <em>RRM1</em>, <em>RRM2</em>, and <em>RRM2B</em> (all log-transformed using the natural logarithm) in univariable regression as well as hazard ratios for SAMHD1 in multivariable regression models in ara-C-treated AML patients.</p> <p><strong>TCGA cohort</strong></p> <p>EFS<sup>a,h,i</sup></p> <p>complete<sup>c</sup></p> <p>EFS</p> <p>18 months<sup>d</sup></p> <p>OS<sup>b,h,i</sup></p> <p>complete</p> <p>OS</p> <p>18 months</p> <p><strong>TARGET cohort</strong></p> <p>12 months<sup>d</sup></p> <p>12 months</p> <p><strong><sup>a</sup></strong> Event-free survival. <sup>b</sup> Overall survival. <sup>c</sup> Complete follow-up period. <sup>d</sup> Follow-up censored after the first 18 or 12 months after diagnosis. <sup>e</sup> Ribonucleoside-diphosphate reductase (large) subunit M1. <sup>f</sup> Ribonucleoside-diphosphate reductase (small) subunit M2. <sup>g</sup> Ribonucleoside-diphosphate reductase (small) subunit M2B. <sup>h</sup> adjusted for age, sex, and cytogenetic risk group. <sup>i</sup> Shown are hazard ratios, 95% confidence intervals and <em>p</em>-values calculated with Wald test. Bold text indicates <em>p</em>-values < 0.05.</p> <p><strong>Expanded View Figure Legends</strong></p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=29617
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "25939",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "25939",
"original_type": "gene",
"role": "intervention",
"text": "SAMHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y3Z3",
"A0A2R8YCS7",
"Q59H15"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "25939",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "25939",
"original_type": "gene",
"role": "intervention",
"text": "SAMHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y3Z3",
"A0A2R8YCS7",
"Q59H15"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "25939",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "25939",
"original_type": "gene",
"role": "intervention",
"text": "SAMHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y3Z3",
"A0A2R8YCS7",
"Q59H15"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P23921///P31350///Q7LG56",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "RNR",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P27707",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "dCK",
"type": "geneprod",
"uniprot_ids": [
"P27707"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P27707",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "dCK",
"type": "geneprod",
"uniprot_ids": [
"P27707"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P23921///Q7LG56///P31350",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "RNR",
"type": "geneprod",
"uniprot_ids": []
}
] |
||
10.15252/embr.201847533
|
Temporal Activation of LRH-1 and RAR-γ in Human Pluripotent Stem Cells Induces a Functional Naïve-Like State
|
2020
|
Figure 1
|
<sd-panel> <p><strong>Figure 1. 2a2iL induces conversion of primed hPSCs into a naïve-like state.</strong></p> <p>A Determination of a time window for 2a2iL treatment needed to induce a naïve-like pluripotency state in primed hPSCs. One day treatment with 2a followed by the addition of 2a2iL for up to 14 days. Scale bars: 200 µm.</p> <p>B Schematic illustration that outlines induction of the naïve-like state from primed hPSCs. Primed hPSCs were first cultured as single cells in conventional hPSC medium in the presence of ROCK inhibitor (ROCKi) and Y27632 (day 0). The medium was replaced by serum-free medium plus 2a2iL on day 1 without ROCKi. Compact dome-shaped colonies began to appear on day 3. The resultant naïve-like cells were passaged as single cells in the absence of ROCKi on day 5 in 2iL medium. 2a2iL-hPSCs were passaged every 3 to 4 days in 2iL, and kept typical naïve-like morphology for over 50 passages.</p> <p>C Characteristics of 2a2iL-RH6 cells represented by dome-shaped colonies, ALP activity, and a normal male karyotype (46, XY). 2a2iL-RH6 expressed the common pluripotency markers OCT4, NANOG, SOX2, and TRA-1-81, but not SSEA1. Nuclei were stained with 4′, 6-diamidino-2-phenylindole (DAPI) and Propidium iodide (PI). Scale bars: 200, 100, and 50 µm in the inset.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=34462
|
[
{
"ext_dbs": "Uniprot///Uniprot///Uniprot///Uniprot",
"ext_ids": "P09923///P05186///P05187///P10696",
"ext_tax_ids": "9606///9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ALP",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P22083",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SSEA1",
"type": "geneprod",
"uniprot_ids": [
"P22083"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H9S0",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "NANOG",
"type": "geneprod",
"uniprot_ids": [
"Q9H9S0"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O00592",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TRA-1-81",
"type": "geneprod",
"uniprot_ids": [
"O00592"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q01860",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "OCT4",
"type": "geneprod",
"uniprot_ids": [
"Q01860"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P48431",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX2",
"type": "geneprod",
"uniprot_ids": [
"P48431"
]
}
] |
||
10.15252/embr.201847533
|
Temporal Activation of LRH-1 and RAR-γ in Human Pluripotent Stem Cells Induces a Functional Naïve-Like State
|
2020
|
Figure 2
|
<sd-panel> <p><strong>Figure 2. 2a2iL-hPSCs show characteristics of naïve pluripotency.</strong></p> <p>A Doubling time in pRH6 versus 2a2iL-RH6. <sup>**</sup>P<0.01 (t-test). Data presented as mean ± SD (n=3).</p> <p>B Cloning efficiency in the presence (+) and absence (−) of ROCK inhibitor (ROCKi) in pRH6 versus 2a2iL-RH6. ROCKi (−)<sup>*</sup>P<0.05, ROCKi (+) <sup>*</sup>P<0.01 (t-test), data presented as mean ± SD (n=3).</p> <p>C Firefly luciferase expression of constructs that contain distal and proximal enhancers of <em>OCT4</em> after transfection of pRh6 and 2a2iL-RH6. The ratio of firefly luciferase expression to Renilla luciferase expression (expressed from co-transfected plasmid) measured 48 h after transfection showed proximal enhancer activity in pRH6 and distal enhancer activation in 2a2iL-RH6. <em>OCT4</em> PE-Luc <sup>***</sup>P<0.001, <em>OCT4</em> DE-Luc <sup>*</sup>P<0.05 (t-test). Data presented as mean ± SD (n=3).</p> <p>D qRT-PCR analysis of pluripotency-related genes in pRH6 and 2a2iL-RH6. <sup>*</sup>P<0.05, <sup>**</sup>P<0.01, <sup>***</sup>P<0.001 (t-test). Data presented as mean ± SD (n=3).</p> <p>E Immunofluorescence staining for several naïve specific markers in 2a2iL-RH6. Scale bar: 100 µm.</p> <p>F Western blot analysis of naïve-related pluripotency markers in pRH6 and 2a2iL-RH6. <sup>**</sup>P<0.01, <sup>***</sup>P<0.001 (t-test). Data presented as mean ± SD (n=3).</p> <p>G Immunofluorescence staining against pRH5 and 2a2iL-RH5 (46, XX) for H3K27me3. Nuclei were stained with 4′, 6-diamidino-2-phenylindole (DAPI). Reactivation of inactive X-chromosome in female 2a2iL-RH5 was confirmed by the lack of H3K27me3 nuclear foci. Scale bar: 50 µm.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=34464
|
[
{
"ext_dbs": "Uniprot///Uniprot",
"ext_ids": "O75116///Q13464",
"ext_tax_ids": "9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "ROCK",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot",
"ext_ids": "O75116///Q13464",
"ext_tax_ids": "9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "ROCK",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot",
"ext_ids": "O75116///Q13464",
"ext_tax_ids": "9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "ROCK",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot",
"ext_ids": "O75116///Q13464",
"ext_tax_ids": "9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "ROCK",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "5460",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "5460",
"original_type": "gene",
"role": "assayed",
"text": "OCT4",
"type": "geneprod",
"uniprot_ids": [
"Q01860",
"D2IYK3",
"F2Z381",
"M1S623"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "5460",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "5460",
"original_type": "gene",
"role": "assayed",
"text": "OCT4",
"type": "geneprod",
"uniprot_ids": [
"Q01860",
"D2IYK3",
"F2Z381",
"M1S623"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "5460",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "5460",
"original_type": "gene",
"role": "assayed",
"text": "OCT4",
"type": "geneprod",
"uniprot_ids": [
"Q01860",
"D2IYK3",
"F2Z381",
"M1S623"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P68431",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "H3",
"type": "geneprod",
"uniprot_ids": [
"P68431"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P68431",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "H3",
"type": "geneprod",
"uniprot_ids": [
"P68431"
]
}
] |
||
10.15252/embr.201847533
|
Temporal Activation of LRH-1 and RAR-γ in Human Pluripotent Stem Cells Induces a Functional Naïve-Like State
|
2020
|
Figure 3
|
<sd-panel> <p><strong>Figure 3. Functional pluripotency assessment of 2a2iL-hPSCs.</strong></p> <p>A Phase contrast images of embryoid bodies (EBs) from 2a2iL-RH6 cells that differentiated into neurons. Scale bars: 200 and 100 µm in the inset.</p> <p>B qRT-PCR analysis of 20 day-EBs from pRH6 and 2a2iL-RH6 for markers of different embryonic germ layer derivatives. <sup>*</sup>P<0.05, <sup>**</sup>P<0.01, <sup>***</sup>P<0.001 (t-test). Data presented as mean ± SD (n=3).</p> <p>C Immunofluorescence images of differentiated 2a2iL-RH6 cells that depict expression of markers for neuron-like cells (TUJ-1), cardiac-muscle-like cells (CTNT), and hepatocyte-like cells (SOX17). Nuclei were stained with 4′, 6-diamidino-2-phenylindole (DAPI). Scale bar: 100 µm.</p> <p>D 2a2iL-RH6 cells form teratomas that consist of three embryonic germ layer-derived tissues. (i) Rosette structures (ectoderm), (ii) cartilage (mesoderm), and (iii) primitive gut (endoderm; scale bar 50 µm).</p> <p>E From left to right: Phase contrast and GFP representation in 2a2iL-RH6-eGFP; presence of injected 2a2iL-RH6-eGFP in the mouse blastocyst and integration into the inner cell mass (ICM) after 3, 24 and 48 h incubation periods. Scale bars: 200, 100, and 50 µm in the inset.</p> <p>F Fluorescence images of tissue-sections from human-mouse chimeras in E10.5 showed cells positive for GFP (top) and human nuclear antigen (HNA) (bottom) in different parts of the embryos, including the head (i), trunk (ii), and tail (iii) with the higher magnification in the right panels. Scale bars: 200 and 100 µm in the inset.</p> <p>G Genomic PCR analysis for a human specific mitochondrial sequence (391 bp) in human-mouse chimeras.</p> <p>H Immunofluorescence staining against NANOG shows lack of expression in E10.5 human-mouse chimera tissue sections. Scale bars: 200 and 100 µm in the inset.</p> <p>I Immunofluorescence staining against TUJ1, BRACHYURY (BRA), and SOX17 in E10.5 human-mouse chimera tissue sections represent differentiation-derivatives of 2a2iL-RH6. Scale bars: 200 and 100 µm in the inset.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=34466
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H6I2",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX17",
"type": "geneprod",
"uniprot_ids": [
"Q9H6I2"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P45379",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "CTNT",
"type": "geneprod",
"uniprot_ids": [
"P45379"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q13509",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TUJ-1",
"type": "geneprod",
"uniprot_ids": [
"Q13509"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P12004",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "HNA",
"type": "geneprod",
"uniprot_ids": [
"P12004"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P12004",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "human nuclear antigen",
"type": "geneprod",
"uniprot_ids": [
"P12004"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H9S0",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "NANOG",
"type": "geneprod",
"uniprot_ids": [
"Q9H9S0"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H6I2",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX17",
"type": "geneprod",
"uniprot_ids": [
"Q9H6I2"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O15178",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BRA",
"type": "geneprod",
"uniprot_ids": [
"O15178"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O15178",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BRACHYURY",
"type": "geneprod",
"uniprot_ids": [
"O15178"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q13509",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TUJ1",
"type": "geneprod",
"uniprot_ids": [
"Q13509"
]
}
] |
||
10.15252/embr.201847533
|
Temporal Activation of LRH-1 and RAR-γ in Human Pluripotent Stem Cells Induces a Functional Naïve-Like State
|
2020
|
Figure 4
|
<sd-panel> <p><strong>Figure 4. 2a2iL allows derivation of naïve-like hESCs from human blastocysts</strong></p> <p>A Schematic overview of protocols used to derive naïve-like hESC lines by 2a2iL from human blastocysts. Two protocols were used to generate naïve hESC lines. In protocol 1, isolated ICMs were cultured in hESCs medium that contained basic fibroblast growth factor (bFGF) for 4 days followed by 2a2iL-supplemented medium until day 10. Dome-shaped colonies representative of the naïve state formed after single-cell dissociation. In protocol 2, ICMs were exposed to 2a2iL-supplemented medium at the beginning of seeding.</p> <p>B Morphology of ICM-outgrowths by protocols 1 and 2 during the first 4 days after seeding. nRH11-14 (naïve Royan H11, 12, 13, and 14): naïve hESC lines produced from human embryos using 2a2iL condition. Scale bar: 100 µm.</p> <p>C Comparison of the efficiency of naïve-like hESCs derivation from human blastocysts by two protocols.</p> <p>D Representative example of naïve-like hESCs (nRH13) at passage 33. Dome-shaped colonies were stained for ALP activity and karyotyped. Scale bars: 200 and 100 µm in the inset.</p> <p>E Expression of the common pluripotency markers OCT4, SOX2, and TRA-1-81, and naïve-related pluripotency markers NANOG, KLF17, and TFCP2L1 in nRH13. Nuclei were stained with 4′, 6-diamidino-2-phenylindole (DAPI). Scale bar: 100 µm.</p> <p>F qRT-PCR analysis for pluripotency markers in nRH13 in comparison to a primed hESC line, pRH6. <sup>*</sup>P<0.05, <sup>**</sup>P<0.01, <sup>***</sup>P<0.001 (t-test). Data presented as mean ± SD (n=3).</p> <p>G Expression of lineage markers after embryoid body (EB) formation and spontaneous differentiation in nRH13 cells. <sup>*</sup>P<0.05, <sup>***</sup>P<0.001 (t-test). Data presented as mean ± SD (n=3).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=34468
|
[
{
"ext_dbs": "Uniprot///Uniprot///Uniprot///Uniprot",
"ext_ids": "P09923///P05186///P05187///P10696",
"ext_tax_ids": "9606///9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ALP",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q5JT82",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "KLF17",
"type": "geneprod",
"uniprot_ids": [
"Q5JT82"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H9S0",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "NANOG",
"type": "geneprod",
"uniprot_ids": [
"Q9H9S0"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O00592",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TRA-1-81",
"type": "geneprod",
"uniprot_ids": [
"O00592"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q01860",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "OCT4",
"type": "geneprod",
"uniprot_ids": [
"Q01860"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P48431",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SOX2",
"type": "geneprod",
"uniprot_ids": [
"P48431"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NZI6",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TFCP2L1",
"type": "geneprod",
"uniprot_ids": [
"Q9NZI6"
]
}
] |
||
10.15252/embr.201847533
|
Temporal Activation of LRH-1 and RAR-γ in Human Pluripotent Stem Cells Induces a Functional Naïve-Like State
|
2020
|
Figure 7
|
<sd-panel> <p><strong>Figure 7. TGFβ-2iL converts primed hPSCs to the naïve state.</strong></p> <p>A qRT-PCR analysis of ligands associated with TGF-β signaling during conversion of primed to naïve-like pluripotency by 2a2iL induction protocol at days 1, 3, and 5. 2iL was selected as a control group. <sup>***</sup>P<0.0001. One-way ANOVA. Data presented as mean ± SD (n=3).</p> <p>B Inhibition of TGF-β pathway using SB43 during conversion of primed to naïve pluripotency. Scale bar: 100 µm.</p> <p>C Morphology of TGFβ2iL-treated RH6 cells along with ALP activity. Scale bar: 200 µm.</p> <p>D qRT-PCR analysis of naïve related genes in pRH6, 2a2iL-, and TGFβ2iL-RH6. <sup>**</sup>P<0.01, <sup>***</sup>P<0.001. One-way ANOVA. Data presented as mean ± SD (n=3).</p> <p>E Bar plot representing cell proliferation rates of 2a2iL- and TGFβ2iL-RH6 by cell counts. <sup>**</sup>P<0.01 (t-test). Data presented as mean ± SD (n=3).</p> <p>F Bar plot of the cloning efficiency of 2a2iL and TGFβ2iL-RH6 based on the number of ALP positive colonies. <sup>***</sup>P<0.001 (t-test). Data presented as mean ± SD (n=3).</p> <p>G Immunofluorescence images show the expression of naïve pluripotency markers in TGF-β2iL-RH6. Nuclei were stained with 4′, 6-diamidino-2-phenylindole (DAPI). Scale bar: 100 µm.</p> <p><strong>Table 1.</strong> Primer sequences and reaction conditions of qRT-PCR or PCR.</p> <p><strong>Annealing</strong></p> <p><strong>temperature (°C)</strong></p> <p>F: ctc att tcc tgg tat gac aac ga</p> <p>R: ctt cct ctt gtg ctc ttg ct</p> <p>F: ctg ggt tga tcc tcg gac ct</p> <p>R: cac aga act cat acg gcg gg</p> <p>F: aaa gaa tct tca cct atg cc</p> <p>R: gaa gga aga gga gag aca gt</p> <p>F: ggg aaa tgg aag ggg tgc aaa aga gg</p> <p>R: ttg cgt gag tgt gga tgg gat tgg tg</p> <p>F: att acc aag agc tca tgc ca</p> <p>R:cct tga gat ggg aac tct ttg</p> <p>F: ttt acg ttt ggg agg agg</p> <p>R: gtg gtc agc tat tca gga g</p> <p>F: aaa gct tcc gat aga ggg ga</p> <p>R: tgc tca ccg aag aaa att cc</p> <p>F: ttt gaa gac cat gga gcc cg</p> <p>R: aca ttc gcc ttc ccg act tg</p> <p>F: ggc aag acc tac acc aag ag</p> <p>R: cac aga tgg cac tgg aat gg</p> <p>F: cct ggt cca gac aag atg tga</p> <p>R: gaa ctg gtc tac gac tga ggc</p> <p>F: gtc gtg gtt tac ggc tcc tat</p> <p>R: ggc aag ttt gag cat ccc tc</p> <p>F: ttg ctg atg cca tcc ctt act</p> <p>R: agctgacatatctggaggtgaa</p> <p>F: gcc cag ttg cag agg act c</p> <p>R: tct tgt tcc ata agc gca ttc t</p> <p>F: cag ccc gag cac tac aac c</p> <p>R: ctc cca gct tcc gat tct cc</p> <p>F: cac aac tcg gag atc agc aa</p> <p>R: ggt act tgt aat ccg ggt gc</p> <p>F: gtc cat ctt tgc ttg gga aa</p> <p>R: tag cca ggt tgc gaa gaa ct</p> <p>F: gta tcc cga ccg cat cat</p> <p>R: tct cat ccg tgt tct cca</p> <p>F: tcc agg aac gga aaa tca ag</p> <p>R: gcc tcc tca tcc cct act tc</p> <p>F: cct gtc atc tca cta cgg</p> <p>R: gct gtt cca aga gtc ctg</p> <p>F: aat tgg tcc agc ctt gga at</p> <p>R: cgt tgc tca cag acc aca</p> <p>F: atg atg cat ttt ggg ggt ta</p> <p>R: cag cac ctt cct cct ctc ag</p> <p>F: aaa tgc gtt tct cgt tgc tt</p> <p>R: gcc aca ggc caa tag ttt gt</p> <p>F: gga gcg gtg aag atg gaa</p> <p>R: tac gtg ttc atg ccg ttc at</p> <p>F: ctc tgc ctc ctc cac gaa</p> <p>R: cag aat cca gac ctg cac aa</p> <p>F: tcc cag ctc tta cct tac ca</p> <p>F: aaa ctc ctt ccc atc ctg ata ctc</p> <p>F: cca acc tta ggg agt aac act g</p> <p>R: ggg agt gct gct tct ttc tg</p> <p>F: atg aag tca agg cta acc agc</p> <p>R: cgt cat cgt cgt aca gga aga g</p> <p>F: gtctttcttccgttctgatgag</p> <p>R: ttcttcattcacctaaggacca</p> <p>F: aactatctcctactactctttccc</p> <p>R: cactcctcttcctatatgcct</p> <p>F: agacaccagttctacctcct</p> <p>R: ggtctctggaatattgctctg</p> <p>F: gcg tac atg ctg agc ctc ta</p> <p>R: ggt gac ctg gga caa agt g</p> <p>F: ctttgtcccgtgtgtggagat</p> <p>R: gtcggcccttacagcttcta</p> <p>F: gaacgtacttctttcacccac</p> <p>R: ttcctgaaccaaacctttactg</p> <p>F: gacttgatgacacgtaccttcg</p> <p>R: agcgtgacacttggagtcct</p> <p>F: tgctacaggtgtcggtgcagagg</p> <p>R: agaaacggacacttgaaggccagg</p> <p>F: gggaattgggatacctggat</p> <p>R: ctaaatatgcacgggcaagg</p> <p>F: tagacatcgtactacacgacacg</p> <p>R: tccaggtttatggagggttc</p> <p><em><sup>*</sup>BRA</em>: Brachyury</p> <p><strong>Table 2.</strong> Primary and secondary antibodies used for immunofluorescence staining.</p> <p><em><sup>*</sup></em>HNA: Human nuclear antigen</p> <p><strong><br></strong></p> <p><strong>Expanded View Figure legends</strong></p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=34473
|
[
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P10600///P61812///P01137",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "TGF-β",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot///Uniprot",
"ext_ids": "P05186///P05187///P10696///P09923",
"ext_tax_ids": "9606///9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ALP",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P01137",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "TGFβ",
"type": "geneprod",
"uniprot_ids": [
"P01137"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P01137",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "TGFβ",
"type": "geneprod",
"uniprot_ids": [
"P01137"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot///Uniprot",
"ext_ids": "P09923///P05186///P05187///P10696",
"ext_tax_ids": "9606///9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ALP",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P01137",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "TGFβ",
"type": "geneprod",
"uniprot_ids": [
"P01137"
]
}
] |
||
10.15252/embr.202255536
|
STING agonism turns human T cells into interferon-producing cells but impedes their functionality
|
2023
|
Figure 1
|
<h2 id="figure-1.-cgamp-treatment-in-addition-with-tcr-stimulation-leads-to-antiviral-cytokine-release-in-primary-human-t-cells">Figure 1. cGAMP treatment in addition with TCR stimulation leads to antiviral cytokine release in primary human T cells</h2><ol type="A"> <li> <p>CD4 and CD8 T cells were stimulated with cGAMP (20 μg/ml) and αCD3/CD28 beads as indicated. Cell lysates after 4 h of stimulation were analyzed by immunoblotting. Blots depict one representative donor out of three.</p> </li> <li> <p>CD4 T cells were stimulated with cGAMP (20 μg/ml) and αCD3/CD28; and human IFNβ (top) and IP10 levels (bottom) in the supernatant were analyzed by ELISA at the indicated time points. Data panels depict mean ± SD of biological duplicates from three independent donors.</p> </li> <li> <p>Statistics from (B) across all three donors, indicate significance by a repeated measures two-way ANOVA with Dunnett correction for multiple testing: ****p < 0.0001; **p < 0.01; ns, not significant.</p> </li> <li> <p>CD4 T cells were pre-treated with cycloheximide (2 μg/ml) for 2 h, then treated with cGAMP (20 μg/ml) and αCD3/CD28 (3/28) for 4 h. Lysates were analyzed by immunoblotting. One representative donor out of two is shown.</p> </li> <li> <p>CD4 T cells were pre-treated with cycloheximide (2 μg/ml) for 2 h, then treated with cGAMP (20 μg/ml) and αCD3/CD28 (3/28) for 4 h, then analyzed by quantitative PCR for <em>IFNB1</em> and <em>OASL</em> expression. Data are depicted as mean + SEM of 3 independent donors (for cGAMP and αCD3/CD28 treated cells without CHX only 2 data points were obtained). Statistics were determined by a two-way ANOVA on log-transformed data using Šidák correction for multiple testing: ***p < 0.001; **p < 0.01; *p < 0.05; ns, not significant.</p> </li> </ol>
|
https://api.sourcedata.io/file.php?figure_id=52046
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P10747",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD28",
"type": "geneprod",
"uniprot_ids": [
"P10747"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P07766///P09693///P04234",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P10747",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD28",
"type": "geneprod",
"uniprot_ids": [
"P10747"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P07766///P09693///P04234",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P02778",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IP10",
"type": "geneprod",
"uniprot_ids": [
"P02778"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P01574",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IFNβ",
"type": "geneprod",
"uniprot_ids": [
"P01574"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "3456",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3456",
"original_type": "gene",
"role": "assayed",
"text": "IFNB1",
"type": "geneprod",
"uniprot_ids": [
"P01574"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "8638",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "8638",
"original_type": "gene",
"role": "assayed",
"text": "OASL",
"type": "geneprod",
"uniprot_ids": [
"Q15646",
"A0A7P0T9H8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P10747",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD28",
"type": "geneprod",
"uniprot_ids": [
"P10747"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P10747",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD28",
"type": "geneprod",
"uniprot_ids": [
"P10747"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P07766///P09693///P04234",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P07766///P09693///P04234",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD3",
"type": "geneprod",
"uniprot_ids": []
}
] |
||
10.15252/embr.202255536
|
STING agonism turns human T cells into interferon-producing cells but impedes their functionality
|
2023
|
Figure 2
|
<h2 id="figure-2.-primary-human-t-cells-display-canonical-sting-signaling">Figure 2. Primary human T cells display canonical STING signaling</h2><ol type="A"> <li> <p>Pooled CD4 T cell WT and <em>STING1</em><sup>-/-</sup> clones were stimulated in triplicates with cGAMP (20 μg/ml) and αCD3/CD28 for 4 h and analyzed by RNA sequencing. Principal component analysis based on the top 5000 highly variable genes (HVGs).</p> </li> <li> <p>Heatmap showing interferon stimulated genes (ISGs) among the top 100 HVGs according to (Samarajiwa <em>et al</em>, 2009) clustered hierarchically across all conditions and replicates. Color coding corresponds to normalized and log2 transformed read counts. Genes differentially expressed between cGAMP-treated and cGAMP + αCD3/CD28-treated conditions are annotated.</p> </li> <li> <p>CRISPR/Cas9 targeted CD4 T cells for indicated genes were treated with cGAMP (20μg/ml) and αCD3/CD28 beads for 48 h. Human IFNβ levels were analyzed by ELISA. Data panels depict mean of biological duplicates from three independent donors.</p> </li> <li> <p>Statistics from (C) across all three donors, indicate significance by a repeated measures two-way ANOVA with Dunnett correction for multiple testing: ****p < 0.0001; ***p < 0.001; *p < 0.05; ns, not significant.</p> </li> <li> <p>CD4 T cells were stimulated with the indicated stimuli for 4 h. Lysates were analyzed by immunoblotting. One representative donor out of three is shown.</p> </li> <li> <p>CRISPR/Cas9 targeted CD4 T cells for the indicated genes were treated with the indicated stimuli for 48 h. Human IFNβ levels were analyzed by ELISA. Data are depicted as mean + SEM of 3 independent donors. Statistics indicate significance by two-way ANOVA with Dunnett correction for multiple testing: ****p < 0.0001; ns, not significant.</p> </li> </ol>
|
https://api.sourcedata.io/file.php?figure_id=52048
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P01574",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IFNβ",
"type": "geneprod",
"uniprot_ids": [
"P01574"
]
}
] |
||
10.15252/embr.202255536
|
STING agonism turns human T cells into interferon-producing cells but impedes their functionality
|
2023
|
Figure 3
|
<h2 id="figure-3.-critical-role-for-nf-kb-signaling-in-sting-driven-antiviral-immunity">Figure 3. Critical role for NF-kB signaling in STING-driven antiviral immunity</h2><ol type="A"> <li> <p>Simplified model of signaling downstream of TCR engagement.</p> </li> <li> <p>CD4 T cells were pre-treated with Dasatinib (100, 10, 1 and 0.1 nM), Tacrolimus (1000, 100, 10 and 1 nM), TPCA-1 (4, 2, 1 and 0.5 μM) and Torin1 (50, 5, 0.5 and 0.05 nM) for 30 min, then treated with cGAMP (20 μg/ml) and αCD3/CD28 for 16 h. Ηuman IFNβ levels in the supernatant were analyzed by ELISA. Data panels depict mean of biological duplicates from three independent donors.</p> </li> <li> <p>CD4 T cells were treated with cGAMP (20 μg/ml) and indicated additional stimuli for 16 h. Human IFNβ levels were analyzed by ELISA. Data panels depict mean of biological duplicates from three independent donors (for cGAMP and PHA treated cells of Donor C only one data point was obtained).</p> </li> <li> <p>CD4 T cells were treated with cGAMP and indicated stimuli together with increasing concentrations of TPCA-1 for 4 h. Cell lysates were analyzed by immunoblotting. One representative donor out of two is shown.</p> </li> <li> <p>CD4 T cells were stimulated with cGAMP (20 μg/ml) and additional stimuli as indicated. Cell lysates after 4 h of stimulation were analyzed by immunoblotting. One representative donor out of two is shown.</p> </li> <li> <p>CD4 T cells were stimulated with cGAMP (20 μg/ml) and additional stimuli as indicated. Cell lysates after 4 h of stimulation were analyzed by immunoblotting. One representative donor out of two is shown.</p> </li> </ol>
|
https://api.sourcedata.io/file.php?figure_id=52050
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P01574",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IFNβ",
"type": "geneprod",
"uniprot_ids": [
"P01574"
]
}
] |
||
10.15252/embr.202255536
|
STING agonism turns human T cells into interferon-producing cells but impedes their functionality
|
2023
|
Figure 4
|
<h2 id="figure-4.-sting-activation-induces-cell-death-in-primary-human-t-cells.">Figure 4. STING activation induces cell death in primary human T cells.</h2><ol type="A"> <li> <p>Freshly isolated CD4 T cells were treated with cGAMP, αCD3/CD28 beads and ABT737/S63845 (A/S) for 48 h and analyzed by flow cytometry. Treatment induced cell death was assessed by Annexin V and propidium iodide staining. Data are depicted as mean + SEM of 3 independent donors. Statistics indicate significance by two-way ANOVA with Dunnett correction for multiple testing: ***p < 0.001; *p < 0.05; ns, not significant.</p> </li> <li> <p>Freshly isolated CD4 (left) and CD8 (right) T cells were treated as indicated for 48 h and analyzed by flow cytometry. Treatment induced cell death was assessed by Annexin V and propidium iodide staining. Data are depicted as mean + SEM of 4 (CD4) or 3 (CD8) independent donors. Statistics indicate significance by two-way ANOVA with Šidák correction for multiple testing: **p < 0.01; ns, not significant.</p> </li> <li> <p>CD4 T cells were treated with indicated concentrations of cGAMP for 18 h, and ABT737/S63845 for 2 h. Lysates and supernatant precipitations were analyzed by immunoblotting. One representative donor out of two is shown.</p> </li> <li> <p>CRISPR/Cas9 targeted CD4 T cells for indicated genes were treated with the indicated stimuli for 48 h and analyzed by flow cytometry. Each panel shows propidium iodide and Annexin V intensity for one representative donor out of three. Digits indicate the percentage of the parental population (single events without subcellular debris).</p> </li> <li> <p>Summary from (D), whereas data are depicted as mean + SEM of 3 independent donors. Statistics indicate significance by two-way ANOVA with Dunnett correction for multiple testing: **p < 0.01; ns, not significant.</p> </li> </ol>
|
https://api.sourcedata.io/file.php?figure_id=52052
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P08758",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Annexin V",
"type": "geneprod",
"uniprot_ids": [
"P08758"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P10747",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD28",
"type": "geneprod",
"uniprot_ids": [
"P10747"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P07766///P09693///P04234",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P08758",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Annexin V",
"type": "geneprod",
"uniprot_ids": [
"P08758"
]
}
] |
||
10.15252/embr.202255536
|
STING agonism turns human T cells into interferon-producing cells but impedes their functionality
|
2023
|
Figure 5
|
<h2 id="figure-5.-sting-activation-impairs-proliferation-in-primary-human-t-cells.">Figure 5. STING activation impairs proliferation in primary human T cells.</h2><ol type="A"> <li> <p>CellTrace Violet (CTV) stained, freshly isolated CD4 and CD8 T cells were activated with αCD3/CD28 beads, stimulated with cGAMP for 96 h and analyzed by flow cytometry. Each panel shows profiles from activated (black), cGAMP-treated (green) and resting (light gray) single and live cells from one representative donor.</p> </li> <li> <p>Summary from (A) across four (CD4) or six (CD8) independent donors. Division indices for each condition were calculated using proliferation modeling. Plot shows log2 transformed fold changes (log2FC) of division indices of treated samples compared to those of activated samples without any additional treatment. Individual data points ± SEM are shown. Statistics indicate significance by one-sample t-test: ***p < 0.001; **p < 0.01.</p> </li> <li> <p>CRISPR/Cas9 targeted CD4 T cells for indicated genes were treated with cGAMP for 96 h, analyzed by flow cytometry and subjected to the same analysis as in (A). Two representative donors out of three are shown.</p> </li> <li> <p>Summary of (C) across 3 independent donors, analyzed as in (B). Data are depicted as mean ± SEM of 3 independent donors. Statistics indicate significance by one-way ANOVA with Dunnett correction for multiple testing: *p < 0.05; ns, not significant.</p> </li> <li> <p>Freshly isolated CD4 T cells were treated with cGAMP (40 μg/ml) and αCD3/CD28 (3/28) for 48 h and analyzed by Seahorse XF mito stress test. Data are depicted as mean ± SEM of 3 independent donors. Statistics indicate significance by two-way ANOVA with Šidák correction for multiple testing: **p < 0.01; *p < 0.05; ns, not significant.</p> </li> <li> <p>Cells treated as in (E) were subjected to the Seahorse XF glycolysis stress test. Data are depicted as mean ± SEM of 3 independent donors. Statistics indicate significance by two-way ANOVA with Šidák correction for multiple testing: **p < 0.01; *p < 0.05; ns, not significant.</p> </li> </ol><h1 id="expanded-view-figure-legends">Expanded View Figure legends</h1>
|
https://api.sourcedata.io/file.php?figure_id=52054
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P10747",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD28",
"type": "geneprod",
"uniprot_ids": [
"P10747"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P07766///P09693///P04234",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P10747",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD28",
"type": "geneprod",
"uniprot_ids": [
"P10747"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P07766///P09693///P04234",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "CD3",
"type": "geneprod",
"uniprot_ids": []
}
] |
||
10.15252/embj.2022111473
|
BRD4-PRC2 Represses Transcription of T-helper 2-Specific Negative Regulators during T-cell Differentiation
|
2023
|
Figure 1
|
<p><strong>Fig. 1. Brd4 represses a key gene transcriptional program during Th2 cell differentiation.</strong></p><p><em>(A)</em> Volcano plot of RNA-seq data showing differential expression of mRNA transcripts in mouse Th2 cells treated with or without JQ1 (250nM). Data are representative of two biological replicates. <em>(B)</em> Global ChIP-seq analysis of Brd4 occupancy at the genomic regions of mouse Th2 cells treated with or without JQ1 (250nM). Data are representative of three biological replicates.</p><p><em>(C)</em> Identification of direct targets of BRD4-activated and -repressed genes in Th2 cells.</p><p><em>(D)</em> Brd4 ChIP-seq intensity associated with BRD4-activated and -repressed genes in Th2 cells, treated with or without JQ1.</p><p><em>(E)</em> Gene ontology (GO) analysis of direct targets of BRD4-activated and -repressed genes in Th2 cells.</p><p><em>(F)</em> ChIP-seq tracks Brd4 on select genes (<em>Foxp3</em>, <em>Nr4a2</em>, <em>Med1</em>, <em>Taf10</em>, <em>Ar</em>, and <em>Fbxw7</em>) in Th2 cells, treated with or without JQ1.</p><p><em>(G)</em> Heatmap of RNA-seq analysis showing up- and down-regulation of select genes in Th2 cells, treated with or without JQ1.</p><p>Data information: Mouse naïve CD4<sup>+</sup> T cells were cultured in Th2 polarization condition and treated with or without inhibitors on Day 0 and were differentiated for 6 days before analysis, unless otherwise specified.</p>
|
https://api.sourcedata.io/file.php?figure_id=52270
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "11835",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "11835",
"original_type": "gene",
"role": "assayed",
"text": "Ar",
"type": "geneprod",
"uniprot_ids": [
"P19091"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "50754",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "50754",
"original_type": "gene",
"role": "assayed",
"text": "Fbxw7",
"type": "geneprod",
"uniprot_ids": [
"Q8VBV4",
"D3YUA8"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20371",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20371",
"original_type": "gene",
"role": "assayed",
"text": "Foxp3",
"type": "geneprod",
"uniprot_ids": [
"Q99JB6",
"Q53Z59"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "19014",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "19014",
"original_type": "gene",
"role": "assayed",
"text": "Med1",
"type": "geneprod",
"uniprot_ids": [
"Q925J9",
"B1AQH6"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "18227",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "18227",
"original_type": "gene",
"role": "assayed",
"text": "Nr4a2",
"type": "geneprod",
"uniprot_ids": [
"Q06219",
"A2AQQ8",
"Q3TYI4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "24075",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "24075",
"original_type": "gene",
"role": "assayed",
"text": "Taf10",
"type": "geneprod",
"uniprot_ids": [
"Q8K0H5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9ESU6",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Brd4",
"type": "geneprod",
"uniprot_ids": [
"Q9ESU6"
]
}
] |
||
10.15252/embj.2022111473
|
BRD4-PRC2 Represses Transcription of T-helper 2-Specific Negative Regulators during T-cell Differentiation
|
2023
|
Figure 2
|
<p><strong>Fig. 2. Foxp3 inhibits <em>Gata3</em> gene transcription while <em>Fbxw7</em> promotes Gata3 protein degradation.</strong> <em>(A)</em> ATAC-seq tracks of accessible <em>cis</em>-regulatory regions of <em>Foxp3</em>, <em>Fbxw7, Gata3, and Il4-13</em> in mouse naïve, Th1, Th2, Th17 and Treg cells.</p><p><em>(B)</em> qPCR analysis of <em>Il4, Il5, Il13, Gata3, Foxp3</em> and <em>Fbxw7</em> in mouse Th2 cells infected with sh-Ctrl, sh-Foxp3, and sh-Fbxw7 lenti-virus.</p><p><em>(C)</em> Immunoprecipitation of Flag-tagged Fbxw7 with anti-Flag affinity gel, followed by Western blotting of Myc to detect Myc-Gata3 in HEK293T cells transfected with Myc-Gata3 and/or Flag-Fbxw7 plasmids.</p><p><em>(D)</em> Flow cytometric (<em>left</em>) and statistical analysis (<em>right</em>) of IL-4 and Gata3 in mouse Th2 cells infected with sh-ctrl and sh-Fbxw7.</p><p><em>(E)</em> Flow cytometric analysis of IL-4 and Gata3 in mouse naïve CD4<sup>+</sup> T cells cultured in Th2 polarization were treated with JQ1 (500nM) at Day 0, and then treated with DMSO or MG132 (20μM) for 6hrs before harvest.</p><p><em>(F)</em> Western blotting of Gata3 in mouse Th2 cells treated with or without JQ1 (500nM), and then treated with cycloheximide (CHX; 25μg/ml) for 0h, 0.5h, 1h and 2h before harvest to stop protein synthesis.</p><p><em>(G)</em> Co-IP to immunoprecipitated Gata3, followed by Western blotting of ubiquitin in mouse naïve CD4<sup>+</sup> T cells cultured in Th2 polarization treated with JQ1 (500nM) at Day 0, and then treated with DMSO or MG132 (20μM) for 6hrs before harvest.</p><p>Data information: Mouse naïve CD4<sup>+</sup> T cells were cultured in Th2 polarization condition and treated with or without inhibitors on Day 0 and were differentiated for 6 days before analysis, unless otherwise specified. All Western blotting data are representative of three independent experiments. All data represent mean±SD and average of three independent experiments. Data are analyzed by Paired t test. *p<0.05; **p<0.01; and ***p< 0.001.</p>
|
https://api.sourcedata.io/file.php?figure_id=52272
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "50754",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "50754",
"original_type": "gene",
"role": "assayed",
"text": "Fbxw7",
"type": "geneprod",
"uniprot_ids": [
"Q8VBV4",
"D3YUA8"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "50754",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "50754",
"original_type": "gene",
"role": "intervention",
"text": "Fbxw7",
"type": "geneprod",
"uniprot_ids": [
"Q8VBV4",
"D3YUA8"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20371",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20371",
"original_type": "gene",
"role": "assayed",
"text": "Foxp3",
"type": "geneprod",
"uniprot_ids": [
"Q99JB6",
"Q53Z59"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20371",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20371",
"original_type": "gene",
"role": "intervention",
"text": "Foxp3",
"type": "geneprod",
"uniprot_ids": [
"Q99JB6",
"Q53Z59"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "14462",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "14462",
"original_type": "gene",
"role": "assayed",
"text": "Gata3",
"type": "geneprod",
"uniprot_ids": [
"P23772",
"Q3U0R5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "16163",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "16163",
"original_type": "gene",
"role": "assayed",
"text": "Il13",
"type": "geneprod",
"uniprot_ids": [
"P20109"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "16189",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "16189",
"original_type": "gene",
"role": "assayed",
"text": "Il4",
"type": "geneprod",
"uniprot_ids": [
"P07750"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "16191",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "16191",
"original_type": "gene",
"role": "assayed",
"text": "Il5",
"type": "geneprod",
"uniprot_ids": [
"P04401",
"Q5SV01"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "50754",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "50754",
"original_type": "gene",
"role": "intervention",
"text": "Fbxw7",
"type": "geneprod",
"uniprot_ids": [
"Q8VBV4",
"D3YUA8"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "14462",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "14462",
"original_type": "gene",
"role": "intervention",
"text": "Gata3",
"type": "geneprod",
"uniprot_ids": [
"P23772",
"Q3U0R5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8VBV4",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Fbxw7",
"type": "geneprod",
"uniprot_ids": [
"Q8VBV4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23772",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Gata3",
"type": "geneprod",
"uniprot_ids": [
"P23772"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23772",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Gata3",
"type": "geneprod",
"uniprot_ids": [
"P23772"
]
}
] |
||
10.15252/embj.2022111473
|
BRD4-PRC2 Represses Transcription of T-helper 2-Specific Negative Regulators during T-cell Differentiation
|
2023
|
Figure 3
|
<p><strong>Fig. 3. Brd4 recruits PRC2 subunits to repress Th2 negative regulators through H3K27me3.</strong></p><p><em><strong>(A)</strong></em> ChIP-seq tracks of Gata3 and Brd4 co-occupancy on the gene loci of <em>Il4</em>, <em>Il5</em>, <em>Il13, Foxp3</em> and <em>Fbxw7</em> in mouse Th2 cells.</p><p><em>(B)</em> ChIP-qPCR analysis of the binding of Brd4 on the gene loci of <em>Il4, Il5, Il13, Foxp3</em> and <em>Fbxw7</em> in mouse Th2 cells, retrovirally transduced with vectors expressing shRNA targeting YY1 and Gata3.</p><p><em>(C)</em> ChIP-qPCR analysis of histone modifications on the gene loci of <em>Foxp3</em> and <em>Fbxw7</em> in mouse Th2 cells treated with or without JQ1 (250nM).</p><p><em>(D)</em> Immunoprecipitation of Brd4 in mouse Th2 cells, followed by Western blotting of Ezh2, Suz12, EED and G9a.</p><p><em>(E)</em> ChIP-qPCR analysis of Brd4, Ezh2, Suz12 and EED binding on the gene loci of <em>Foxp3</em> and <em>Fbxw7</em> in mouse Th2 cells <em>versus</em> Th0 cells cultured for 3 days.</p><p><em>(F)</em> ChIP-qPCR analysis of Brd4, Ezh2, Suz12 and EED binding on the gene loci of <em>Il4</em>, <em>Il5</em>, <em>Foxp3</em> and <em>Fbxw7</em> in mouse Th2 cells treat with or without JQ1 (250nM).</p><p>Data information: Mouse naïve CD4<sup>+</sup> T cells were cultured in Th2 polarization condition and treated with or without inhibitors on Day 0 and were differentiated for 6 days before analysis, unless otherwise specified. All Western blotting data are representative of three independent experiments. All ChIP-qPCR data represent mean±SD and are representative of three independent experiments. Data are analyzed by Paired t test. *p<0.05; **p<0.01; and ***p< 0.001.</p>
|
https://api.sourcedata.io/file.php?figure_id=52274
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "50754",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "50754",
"original_type": "gene",
"role": "assayed",
"text": "Fbxw7",
"type": "geneprod",
"uniprot_ids": [
"Q8VBV4",
"D3YUA8"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20371",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20371",
"original_type": "gene",
"role": "assayed",
"text": "Foxp3",
"type": "geneprod",
"uniprot_ids": [
"Q99JB6",
"Q53Z59"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot///Uniprot///Uniprot///Uniprot///Uniprot",
"ext_ids": "P70696///Q9Z2V6///Q9D2U9///P68433///P84244///P84228///P02301",
"ext_tax_ids": "10090///10090///10090///10090///10090///10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus///Mus musculus///Mus musculus///Mus musculus///Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "histone",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9ESU6",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Brd4",
"type": "geneprod",
"uniprot_ids": [
"Q9ESU6"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q921E6",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "EED",
"type": "geneprod",
"uniprot_ids": [
"Q921E6"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Z148",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "G9a",
"type": "geneprod",
"uniprot_ids": [
"Q9Z148"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q61188",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Ezh2",
"type": "geneprod",
"uniprot_ids": [
"Q61188"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q80U70",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Suz12",
"type": "geneprod",
"uniprot_ids": [
"Q80U70"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "50754",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "50754",
"original_type": "gene",
"role": "assayed",
"text": "Fbxw7",
"type": "geneprod",
"uniprot_ids": [
"Q8VBV4",
"D3YUA8"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20371",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20371",
"original_type": "gene",
"role": "assayed",
"text": "Foxp3",
"type": "geneprod",
"uniprot_ids": [
"Q99JB6",
"Q53Z59"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "16189",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "16189",
"original_type": "gene",
"role": "assayed",
"text": "Il4",
"type": "geneprod",
"uniprot_ids": [
"P07750"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "16191",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "16191",
"original_type": "gene",
"role": "assayed",
"text": "Il5",
"type": "geneprod",
"uniprot_ids": [
"P04401",
"Q5SV01"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9ESU6",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Brd4",
"type": "geneprod",
"uniprot_ids": [
"Q9ESU6"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q921E6",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "EED",
"type": "geneprod",
"uniprot_ids": [
"Q921E6"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q61188",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Ezh2",
"type": "geneprod",
"uniprot_ids": [
"Q61188"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q80U70",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Suz12",
"type": "geneprod",
"uniprot_ids": [
"Q80U70"
]
}
] |
||
10.15252/embj.2022111473
|
BRD4-PRC2 Represses Transcription of T-helper 2-Specific Negative Regulators during T-cell Differentiation
|
2023
|
Figure 4
|
<p><strong>Fig. 4. Brd4-BD2 binds acetylated-EED to repress <em>Foxp3</em> and <em>Fbxw7</em> in Th2 cells.</strong></p><p><em>(A)</em> Immunoprecipitation of Flag-tagged Brd4, followed by Western blotting of HA to detect HA-Ezh2, HA-EED and HA-Suz12 in HEK293T cells transfected with Flag-Brd4 and/or HA-Ezh2, HA-EED and HA-Suz12 plasmids.</p><p><em>(B)</em> HEK293T cells are transfected with Flag-Brd4 and HA-EED, HA-Ezh2, and Suz12 plasmids. Lysates are immunoprecipitated with Flag-tagged Brd4, treated <em>in-vitro</em> with JQ1 (5μM), MS402 (5μM), and ABBV-744 (5μM), followed by Western blotting of HA.</p><p><em>(C)</em> Th2 cells were differentiated for 6 days. Lysates are immunoprecipitated with Brd4, treated in-vitro with ABBV-744 (5μM), followed by Western blotting of EED, Ezh2 and Suz12.</p><p><em>(D)</em> HEK293T cells are transfected with Flag-Brd4 and HA-EED plasmids. Lysates are immunoprecipitated with HA, followed by Western blotting of HA and pan-acetylation (pan-Ac). * denotes specific bands.</p><p><em>(E)</em> HEK293T cells are transfected with Flag-Brd4 and HA-EED plasmids. Lysates are immunoprecipitated with Flag-tagged Brd4, treated <em>in-vitro</em> with 10μM acetylated EED peptides (K19, K211, K250, K261) and non-acetylated EED-K19 peptide, followed by Western blotting of HA to detect HA-EED.</p><p><em>(F)</em> HEK293T cells are transfected with Flag-Brd4, HA-EED and HA-EED(K19R) plasmids. Lysates are immunoprecipitated with Flag followed by Western blotting of HA, and <em>vice versa.</em></p><p><em>(G)</em> Dual-luciferase reporter assay of HEK293T cells transfected with Fbxw7-promoter, Flag-Brd4, HA-EED and HA-EED(K19R) plasmids.</p><p>Data information: All Western blotting data are representative of three independent experiments. All data represent mean±SD and are representative of three independent experiments. Data are analyzed by Paired t test. *p<0.05.</p>
|
https://api.sourcedata.io/file.php?figure_id=52276
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9ESU6",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Brd4",
"type": "geneprod",
"uniprot_ids": [
"Q9ESU6"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "13626",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "13626",
"original_type": "gene",
"role": "intervention",
"text": "EED",
"type": "geneprod",
"uniprot_ids": [
"Q921E6"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "13626",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "13626",
"original_type": "gene",
"role": "intervention",
"text": "EED",
"type": "geneprod",
"uniprot_ids": [
"Q921E6"
]
}
] |
||
10.15252/embj.2022111473
|
BRD4-PRC2 Represses Transcription of T-helper 2-Specific Negative Regulators during T-cell Differentiation
|
2023
|
Figure 5
|
<p><strong>Fig. 5. Brd4 through its BD2 domain regulates transcription of Th2-key genes and -negative regulators.</strong></p><p><em>(A)</em> Flow cytometric (<em>left</em>) and statistical analysis (<em>right</em>) of IL-4 and IL-17A in mouse Th2 and Th17 cells treated with BRD4 BD2-selective inhibitor ABBV-744 (1μM) and BD1-selective inhibitor MS611 (2μM), respectively.</p><p><em>(B)</em> qPCR analysis of <em>Il4</em>, <em>Il5</em>, <em>Gata3</em> in mouse Th2 cells treated with ABBV-744 at 500nM and 1μM. <em>(C)</em> Western blotting of Gata3 in mouse Th2 cells treated with or without JQ1.</p><p><em>(D)</em> Western blotting of Gata3 of mouse Th2 cells treated with ABBV-744 (500nM) and MG132 (20μM).</p><p><em>(E)</em> qPCR analysis of <em>Foxp3</em> in mouse Th2 cells treated with ABBV-744 at 500nM and 1μM.</p><p><em>(F)</em> qPCR analysis of <em>Fbxw7</em> in mouse Th2 cells treated with ABBV-744 at 500nM and 1μM.</p><p><em>(G)</em> Schematic diagram illustrating BRD4 functions in control of transcriptional activation and repression of key genes in chromatin that functionally cooperate with each other to regulate Th2 cell program. Histone lysine acetylation and methylation are depicted with color-coded flags in green or red, respectively.</p><p>Data information: Mouse naïve CD4<sup>+</sup> T cells were cultured in Th2 polarization condition and treated with or without inhibitors on Day 0 and were differentiated for 6 days before analysis, unless otherwise specified. All data represent mean±SD and are representative of three independent experiments. Data are analyzed by Paired t test. *p<0.05; **p<0.01; and ***p< 0.001.</p>
|
https://api.sourcedata.io/file.php?figure_id=52278
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "14462",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "14462",
"original_type": "gene",
"role": "assayed",
"text": "Gata3",
"type": "geneprod",
"uniprot_ids": [
"P23772",
"Q3U0R5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "16189",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "16189",
"original_type": "gene",
"role": "assayed",
"text": "Il4",
"type": "geneprod",
"uniprot_ids": [
"P07750"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "16191",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "16191",
"original_type": "gene",
"role": "assayed",
"text": "Il5",
"type": "geneprod",
"uniprot_ids": [
"P04401",
"Q5SV01"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23772",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Gata3",
"type": "geneprod",
"uniprot_ids": [
"P23772"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "50754",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "50754",
"original_type": "gene",
"role": "assayed",
"text": "Fbxw7",
"type": "geneprod",
"uniprot_ids": [
"Q8VBV4",
"D3YUA8"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20371",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20371",
"original_type": "gene",
"role": "assayed",
"text": "Foxp3",
"type": "geneprod",
"uniprot_ids": [
"Q99JB6",
"Q53Z59"
]
}
] |
||
10.15252/emmm.201911589
|
Metabolic effects of bezafibrate in mitochondrial disease
|
2020
|
Figure 2
|
<sd-panel> <p><strong>Figure 2. Metabolic effects of bezafibrate in patients with the m.3243A>G <em>MTTL1</em> mutation.</strong></p> <p>W0, W6 and W12 refer to the week of study.</p> <p>(<strong>A</strong>) Serum FGF-21 and GDF-15 levels before, during and after treatment (two-sided Wilcoxon signed-rank test, <em>P</em>-value = 0.031 in all significant cases) (see Fig. EV2 for details where P1 - P6 refer to the individual patients).</p> <p>(<strong>B</strong>) Volcano plot showing differences in metabolite levels between 0 and 6&12 weeks of treatment. Metabolites in histidine, alanine, aspartate and glutamine metabolism, and the TCA cycle pathways are annotated at 10% False Discovery Rate (see Dataset EV1 for the whole list of differentially regulated metabolites. Although some other metabolites showed a more pronounced difference, these did not fit into a recognised pathway). Metabolite labels are colour-coded according to the identified KEGG pathways (dark red = "Alanine, aspartate and glutamate metabolism", dark green = "Histidine metabolism" and dark blue = "Citrate cycle (TCA cycle)", with transition colour-code if the metabolite belongs to more than one KEGG pathways).</p> <p>(<strong>C</strong>) Scatterplot depicting <em>P</em>-values from the metabolites Pathway Enrichment Analysis (<em>y</em>-axis) and impact values from Pathway Topology Analysis (<em>x</em>-axis) (see Dataset EV2 for details). KEGG pathways at 10% adjusted Holm-Bonferroni <em>P</em>-value are highlighted.</p> <p>(<strong>D</strong>) Volcano plot of acyl-carnitine metabolites between 0 and 6&12 weeks of treatment with highlighted differential metabolites at 10% FDR.</p> <p>(<strong>E</strong>) Respiratory chain complex and citrate synthase activity in skeletal muscle before and after 12 weeks of treatment. No significant differences were detected before and after 12 weeks of treatment by using the two-sided Wilcoxon signed-rank test with an empirical level of significance.</p> <p>Data Information: In (A) and (E) horizontal dotted lines denote the mean values in healthy age-matched controls. In (E) solid horizontal lines and bars represent the mean ± SD of the technical replicates at each time point. Horizontal lines on (A) and (E) refer to statistical comparisons of the mean values, where ns = non-significant, *<em>P</em>-value ≤ 0.05.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=29958
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NSA1",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "FGF-21",
"type": "geneprod",
"uniprot_ids": [
"Q9NSA1"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q99988",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "GDF-15",
"type": "geneprod",
"uniprot_ids": [
"Q99988"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O75390",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "citrate synthase",
"type": "geneprod",
"uniprot_ids": [
"O75390"
]
}
] |
||
10.15252/emmm.201911589
|
Metabolic effects of bezafibrate in mitochondrial disease
|
2020
|
Figure 3
|
<sd-panel> <p><strong>Figure 3. Mitochondrial biogenesis and clinical effects of bezafibrate in patients with the m.3243A>G <em>MTTL1</em> mutation.</strong></p> <p>P1 - P6 refer to individual patients.</p> <p>(<strong>A</strong>) Representative examples of the quadruple immunofluorescence quantification of skeletal muscle fibres before and after treatment. The box in the top right-hand corner indicates the normal range, using two antibodies to NDUFB8 and COX I.</p> <p>(<strong>B</strong>) Quantitative quadruple immunofluorescence of skeletal muscle fibres in the six patients showing a decrease (two-sided Wilcoxon signed-rank test with an empirical level of significance) in the proportion of complex IV deficient skeletal muscle fibres before and after 12 weeks of treatment (empirical <em>P</em>-value = 0.048).</p> <p>(<strong>C</strong>) Hierarchical cluster analysis of skeletal muscle RNA-seq transcripts before and after treatment showing no clear separation between untreated and treated patients.</p> <p>(<strong>D</strong>) Volcano plot depicting differentially expressed RNA-seq genes at 10% FDR after 12 weeks of treatment. Significantly different mammalian mitochondrial genes (MitoCarta 2.0) are annotated.</p> <p>(<strong>E</strong>) Reactome Pathway Analysis of the differentially expressed genes at 10% FDR after 12 weeks of treatment (see Expanded View document for details).</p> <p>(<strong>F</strong>) Percentage level m.3243A>G in blood, urinary sediment and skeletal muscle. No differences were detected by using the two-sided Wilcoxon signed-rank test with an empirical level of significance. W = week of the study.</p> <p>(<strong>G</strong>) Cardiac parameters before and after treatment (two-sided Wilcoxon signed-rank test with an empirical level of significance). ES = end-systolic volume (ml) (empirical <em>P</em>-value = 0.047) and index (ml/m<sup>2</sup>) (empirical <em>P</em>-value = 0.046), measured by MRI. Horizontal lines on (B), (F) and (G) refer to statistical comparisons of the mean values, where ns = non-significant, *<em>P</em>-value ≤ 0.05. For normal reference ranges see (Hollingsworth et al., 2012)</p> <p><strong><br></strong></p> <p><strong>Tables</strong></p> <p><strong>Table 1. Clinical characteristics of the six patients with the m.3243A>G <em>MTTL1</em> mutation and mitochondrial myopathy.</strong></p> <p>(MIDD: mitochondrially inherited diabetes and deafness, NMDAS = Newcastle Mitochondrial Disease Adult Scale).</p> <p>Symptom</p> <p>duration (years)</p> <p><strong>Expanded View Figure Legends</strong></p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=29960
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "O95169",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "NDUFB8",
"type": "geneprod",
"uniprot_ids": [
"O95169"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23219",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "COX I",
"type": "geneprod",
"uniprot_ids": [
"P23219"
]
}
] |
||
10.15252/embr.202254859
|
UBXD8 mediates mitochondria-associated degradation to restrain apoptosis and mitophagy
|
2022
|
Figure 1
|
<sd-panel><p><strong>Figure 1. UBXD8 dually localizes to mitochondria and the ER.</strong></p> <ol type="A"> <li> <p>Schematic of the domain structure and membrane topology of UBXD8, UBXD2, and UBXD6. UBA: <span class="underline">ub</span>iquitin-<span class="underline">a</span>ssociated; HP: hairpin; UAS: <span class="underline">u</span>biquitin <span class="underline">as</span>sociating; UBX: Ubiquitin regulatory X; CC: coiled-coil.</p> </li> <li> <p>Immunofluorescence analysis of exogenously-expressed FLAG-UBXD8, FLAG-UBXD2, and FLAG-UBXD6 in U2OS cells. Scale bar, 5 μm.</p> </li> <li> <p>Schematic, western blot, and immunofluorescence analysis of the 3×FLAG-UBXD8 knockin U2OS cell line. Scale bar, 5 μm.</p> </li> <li> <p>Immunofluorescence analysis of endogenous UBXD8 in U2OS cells. Scale bar, 5 μm.</p> </li> <li> <p>Immunofluorescence analysis of endogenous UBXD8 in WT and ∆UBXD8 HeLa cells. Scale bar, 5 μm.</p> </li> </ol> <p>Data information: In (B, C, D, E), mitochondria were visualized by anti-Tom20 immunostaining; ER was labeled by ER-DsRed or by anti-PDI immunostaining.</p></sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=49132
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P07237",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PDI",
"type": "geneprod",
"uniprot_ids": [
"P07237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q15388",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Tom20",
"type": "geneprod",
"uniprot_ids": [
"Q15388"
]
}
] |
||
10.15252/embr.202254859
|
UBXD8 mediates mitochondria-associated degradation to restrain apoptosis and mitophagy
|
2022
|
Figure 2
|
<sd-panel><p><strong>Figure 2. UBXD8 associates with mitochondrial and ER ubiquitin E3 ligases and recruits VCP to mitochondria and the ER<em>.</em></strong></p> <ol type="A"> <li> <p>Blue native gel analysis of UBXD8 in mitochondrial fractions purified from WT and ∆UBXD8 HeLa cells.</p> </li> <li> <p>Immunoprecipitation analysis of UBXD8 interaction with mitochondrial (MARCH5 and MUL1) and ER (RNF185) ubiquitin E3 ligases. HeLa cells were infected with lentivirus to stably express HA-tagged ubiquitin E3 ligases. Whole cell lysates were prepared for anti-HA immunoprecipitation.</p> </li> <li> <p>Immunoprecipitation analysis of UBXD8 interaction with MARCH5 and RNF185. Whole cell lysates from 3×FLAG-UBXD8 knockin HEK293T cells were prepared for anti-FLAG immunoprecipitation. MARCH5 and RNF185: short exposure for whole cell lysate blots, long exposure for FLAG-IP blots.</p> </li> <li> <p>Fractionation analysis of UBXD8's effect on VCP recruitment to mitochondria and the ER. Whole cell lysate, mitochondria, and ER fractions were purified (see methods for detail) from WT, ∆UBXD8, and ∆UBXD8 HeLa cells rescued with UBXD8 or the UBX* mutant. UBX*-UBXD8 <strong>carries four point mutations (K367A, F407A, P408G, R409A) in the UBX domain to disrupt the UBXD8-VCP interaction. For each sample, 5 μg proteins were loaded for western blot analysis.</strong></p> </li> <li> <p>Quantitative analysis of VCP levels in the mitochondria and ER fractions from the indicated HeLa cells. Data are shown as mean ± SE from three biological repeats. Statistics: <strong>one-way ANOVA;</strong> **<em>P</em> < 0.01, ***<em>P</em> < 0.001.</p> </li> </ol></sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=49134
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q96CS3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q96CS3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NX47",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "MARCH5",
"type": "geneprod",
"uniprot_ids": [
"Q9NX47"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q969V5",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "MUL1",
"type": "geneprod",
"uniprot_ids": [
"Q969V5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q96GF1",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RNF185",
"type": "geneprod",
"uniprot_ids": [
"Q96GF1"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q96CS3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NX47",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "MARCH5",
"type": "geneprod",
"uniprot_ids": [
"Q9NX47"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9NX47",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "MARCH5",
"type": "geneprod",
"uniprot_ids": [
"Q9NX47"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q96GF1",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RNF185",
"type": "geneprod",
"uniprot_ids": [
"Q96GF1"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q96GF1",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RNF185",
"type": "geneprod",
"uniprot_ids": [
"Q96GF1"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q96CS3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P55072",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VCP",
"type": "geneprod",
"uniprot_ids": [
"P55072"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P55072",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VCP",
"type": "geneprod",
"uniprot_ids": [
"P55072"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P55072",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VCP",
"type": "geneprod",
"uniprot_ids": [
"P55072"
]
}
] |
||
10.15252/embr.202254859
|
UBXD8 mediates mitochondria-associated degradation to restrain apoptosis and mitophagy
|
2022
|
Figure 3
|
<sd-panel><p><strong>Figure 3. Both UBXD8 and UBXD2 (ER VCP adaptor) participate in mitochondrial protein degradation.</strong></p> <p>A, B. Western blot (A) and quantitative (B) analyses of MiD49 and Mcl1 degradation in WT and ∆MARCH5 HeLa cells. Cycloheximide (CHX: 200 μg/ml; protein synthesis inhibitor); MG132: 20 μM, proteasome inhibitor.</p> <p>C, D. Western blot (C) and quantitative (D) analyses of Mcl1 degradation in the indicated HeLa cells.</p> <p>E, F. Western blot (E) and quantitative (F) analyses of MiD49 degradation in the indicated HeLa cells.</p> <p>G. Immunofluorescence analysis of MiD49-FLAG localization in the indicated HeLa cells. Scale bar, 5 μm.</p> <p>Data information: Data are shown as mean ± SE from three biological repeats (B, D, F). Statistics: <strong>two-tailed unpaired Student's t-test</strong> (B, D, F)<strong>;</strong> *<em>P</em> < 0.05, **<em>P</em> < 0.01, ***<em>P</em> < 0.001, n.s., not significant.</p></sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=49136
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "54708",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54708",
"original_type": "gene",
"role": "intervention",
"text": "MARCH5",
"type": "geneprod",
"uniprot_ids": [
"Q9NX47"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q07820",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Mcl1",
"type": "geneprod",
"uniprot_ids": [
"Q07820"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q96C03",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "MiD49",
"type": "geneprod",
"uniprot_ids": [
"Q96C03"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q07820",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Mcl1",
"type": "geneprod",
"uniprot_ids": [
"Q07820"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q96C03",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "MiD49",
"type": "geneprod",
"uniprot_ids": [
"Q96C03"
]
}
] |
||
10.15252/embr.202254859
|
UBXD8 mediates mitochondria-associated degradation to restrain apoptosis and mitophagy
|
2022
|
Figure 4
|
<sd-panel><p><strong>Figure 4. UBXD8 degrades mitochondrial and ER substrates <em>in cis</em> and <em>in trans.</em></strong></p> <ol type="A"> <li> <p><strong>Schematic of mito-UBXD8 and ER-UBXD8.</strong></p> </li> </ol> <ol start="2" type="A"> <li> <p><strong>Fractionation analysis of the subcellular localization of mito-UBXD8 and ER-UBXD8.</strong> Whole cell lysate, mitochondria, and ER fractions were purified from the indicated HeLa cells. Exogenously-expressed mito-UBXD8 has similar expression level with endogenous UBXD8 in WT cells; exogenously-expressed WT UBXD8 and ER-UBXD8 have similar expression levels.</p> </li> <li> <p>Immunofluorescence analysis of mito-UBXD8 and ER-UBXD8 localization in U2OS cells. Scale bar, 5 μm.</p> </li> </ol> <p>D, E. Western blot (D) and quantitative (E) analyses of Mcl1 degradation in the indicated HeLa cells. ∆UBXD8 HeLa cells were rescued with vector, WT-, mito-, and ER-UBXD8. Data are shown as mean ± SE from three biological repeats (E). Statistics: <strong>two-tailed unpaired Student's t-test (E);</strong> *<em>P</em> < 0.05, **<em>P</em> < 0.01, ***<em>P</em> < 0.001.</p> <ol start="6" type="A"> <li> <p>Cartoon illustration of the substrate degradation by mitochondrial and ER adaptor-VCP complexes.</p> </li> </ol></sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=49138
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q96CS3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q96CS3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q96CS3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q07820",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Mcl1",
"type": "geneprod",
"uniprot_ids": [
"Q07820"
]
}
] |
||
10.15252/embr.202254859
|
UBXD8 mediates mitochondria-associated degradation to restrain apoptosis and mitophagy
|
2022
|
Figure 5
|
<sd-panel><p><strong>Figure 5. UBXD8 knockout sensitizes cells to mitochondrial stresses and apoptotic insults.</strong></p> <p>A-C, Growth tests of the indicated HeLa cells in response to oligomycin (A), chloramphenicol (B), and ethidium bromide (EB) (C) treatment. Oligo: 10 μM; Chloramphenicol: 300 μg/ml; EB: 50 ng/ml.</p> <ol start="4" type="A"> <li> <p>Cell survival analysis of the indicated HeLa cells treated with Actinomycin D (ActD, 1 μM) or Doxorubicin (Doxo, 10 μM). Representative images are shown. Cell viability was measured by Cell Titer-Glo. Scale bar, 50 μm.</p> </li> <li> <p>Western blot analysis of apoptosis activation (caspase cleavage and PARP cleavage) in the indicated HeLa cells treated similarly as in (D).</p> </li> <li> <p>Cell survival analysis of WT and ∆UBXD8 MCF7 cells treated with ActD (1 μM) or Doxo (10 μM). Cell viability was measured by Cell Titer-Glo.</p> </li> <li> <p>Cell survival analysis of the indicated HeLa cells. 7 × 10<sup>5</sup> cells in one well of 6-well plate were treated with ActD (200 nM) for 4 hours or Doxo (50 nM) for 2 hours and subsequently cultured in normal medium for 21 days. Surviving colonies were stained by 0.1% (W/V) methylene blue. Representative images and quantifications of the surviving colony numbers are shown.</p> </li> </ol> <p>Data information: Data are shown as mean ± SE from three biological repeats (A, B, C, D, F, G). Statistics: <strong>two-tailed unpaired Student's t-test (A, B, C, D, F); one-way ANOVA (G);</strong> *<em>P</em> < 0.05, **<em>P</em> < 0.01, ***<em>P</em> < 0.001.</p></sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=49140
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P42574",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "caspase",
"type": "geneprod",
"uniprot_ids": [
"P42574"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P09874",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PARP",
"type": "geneprod",
"uniprot_ids": [
"P09874"
]
}
] |
||
10.15252/embr.202254859
|
UBXD8 mediates mitochondria-associated degradation to restrain apoptosis and mitophagy
|
2022
|
Figure 6
|
<sd-panel><p><strong>Figure 6. UBXD8 mediates the degradation of multiple BH3-only proteins and restrains apoptosis via Noxa degradation.</strong></p> <ol type="A"> <li> <p>Western blot analysis of BH3-domain containing proteins in the indicated HeLa cells treated with Doxo (10 μM). Three proteins with enhanced level in ∆UBXD8 cells (Noxa, Bik, and Bnip3) are highlighted in red.</p> </li> <li> <p>Western blot and quantitative analysis of Noxa degradation in the indicated HeLa cells.</p> </li> <li> <p>Western blot and quantitative analysis of Bik and Bnip3 degradation in the indicated HeLa cells.</p> </li> </ol> <p>D-G. Western blot (D, F) and cell viability (E, G) analysis of the indicated HeLa cells. Cell viability was measured by Cell Titer-Glo. Dox: 10 μM.</p> <p>Data information: Data are shown as mean ± SE from three biological repeats <strong>(B, C, E, G).</strong> Statistics: <strong>two-tailed unpaired Student's t-test (B, C, E, G);</strong> *<em>P</em> < 0.05, **<em>P</em> < 0.001, ***<em>P</em> < 0.001.</p></sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=49142
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "23197",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23197",
"original_type": "gene",
"role": "intervention",
"text": "UBXD8",
"type": "geneprod",
"uniprot_ids": [
"Q96CS3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q13323",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Bik",
"type": "geneprod",
"uniprot_ids": [
"Q13323"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q12983",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Bnip3",
"type": "geneprod",
"uniprot_ids": [
"Q12983"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q13794",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Noxa",
"type": "geneprod",
"uniprot_ids": [
"Q13794"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q13794",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Noxa",
"type": "geneprod",
"uniprot_ids": [
"Q13794"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q13323",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Bik",
"type": "geneprod",
"uniprot_ids": [
"Q13323"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q12983",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Bnip3",
"type": "geneprod",
"uniprot_ids": [
"Q12983"
]
}
] |
||
10.15252/embr.201847498
|
DDX3X and Specific Initiation Factors Modulate FMR1 Repeat-Associated Non-AUG Initiated translation
|
2019
|
Figure 2
|
<sd-panel> <p><strong>Figure 2. Knockdown of <em>Belle</em> Mitigates Repeat-Associated Toxicity by Inhibiting RAN Translation in <sd-pretag id="sdPretag1082730050sm" type="organism" role="component"><em>Drosophila</em></sd-pretag>.</strong></p> <p>A Representative photographs of fly <sd-pretag id="sdPretag1565301136sm" type="tissue" role="component">eyes</sd-pretag> expressing (<sd-pretag id="sdPretag1220028886sm" type="geneprod" role="component">CGG</sd-pretag>)<sub>90</sub>-<sd-pretag id="sdPretag1126914072sm" type="geneprod" role="reporter">EGFP</sd-pretag> under a <sd-pretag id="sdPretag1839888769sm" type="geneprod" role="component">GMR</sd-pretag>-<sd-pretag id="sdPretag1190097916sm" type="geneprod" role="component">GAL4</sd-pretag> driver, with various <em>belle</em> disruptions.</p> <p>B Quantitation of <sd-pretag id="sdPretag943697075sm" type="geneprod" role="component">GMR</sd-pretag>-<sd-pretag id="sdPretag1980632302sm" type="geneprod" role="component">GAL4</sd-pretag>, (<sd-pretag id="sdPretag2069341189sm" type="geneprod" role="intervention">CGG</sd-pretag>)<sub>90</sub>-<sd-pretag id="sdPretag799719242sm" type="geneprod" role="reporter">EGFP</sd-pretag> <sd-pretag id="sdPretag333929574sm" type="tissue" role="component">eye</sd-pretag> <sd-pretag id="sdPretag1184249181sm" type="cell" role="component">phenotypes</sd-pretag> with <em>belle</em> disruptions (Mann-Whitney U test with Bonferonni corrections for multiple comparisons; <em>n</em>=35-77/genotype).</p> <p>C, D Longevity assays of (<sd-pretag id="sdPretag1749967344sm" type="geneprod" role="intervention">CGG</sd-pretag>)<sub>90</sub>-<sd-pretag id="sdPretag1898618294sm" type="geneprod" role="reporter">EGFP</sd-pretag>; <sd-pretag id="sdPretag1217555973sm" type="geneprod" role="component">Tub5</sd-pretag>-<sd-pretag id="sdPretag661691832sm" type="subcellular" role="component">GS</sd-pretag> (Log-rank Mantel-Cox test with Bonferroni corrections for multiple comparisons; <em>n</em>=110-219/genotype) and (CGG)<sub>90</sub>-<sd-pretag id="sdPretag1407669049sm" type="geneprod" role="reporter">EGFP</sd-pretag>; <sd-pretag id="sdPretag1559373500sm" type="geneprod" role="intervention">ElaV</sd-pretag>-GS (<em>n</em>=147-299/genotype) <sd-pretag id="sdPretag1385018171sm" type="organism" role="component">flies</sd-pretag> with <em>belle</em> knockdown.</p> <p>E <sd-pretag id="sdPretag1907075724sm" category="assay">Western blots</sd-pretag> of the FMRpolyG-<sd-pretag id="sdPretag369046376sm" type="geneprod" role="reporter">EGFP</sd-pretag> RAN product in (<sd-pretag id="sdPretag1423244231sm" type="cell" role="component">CGG</sd-pretag>)<sub>90</sub>-<sd-pretag id="sdPretag1021282029sm" type="geneprod" role="reporter">EGFP</sd-pretag>; <sd-pretag id="sdPretag428429266sm" type="geneprod" role="intervention">Tub5</sd-pretag>-GS <sd-pretag id="sdPretag552844950sm" type="organism" role="component">flies</sd-pretag> with and without <em>belle</em> knockdown by two independent shRNAs.</p> <p>F Quantitation of FMRpolyG-<sd-pretag id="sdPretag1029280098sm" type="geneprod" role="reporter">EGFP</sd-pretag> band density, normalized to β <sd-pretag id="sdPretag310857279sm" type="geneprod" role="assayed">tubulin</sd-pretag> band density, from blots in E (Student's t test; <em>n</em>=4-5/genotype).</p> <p>G Abundance of (CGG)<sub>90</sub>-<sd-pretag id="sdPretag314702623sm" type="geneprod" role="reporter">EGFP</sd-pretag> mRNA normalized to <sd-pretag id="sdPretag1965436761sm" type="geneprod" role="component"><em>RPL32</em></sd-pretag> mRNA, following <em>belle</em> knockdown, determined by <sd-pretag id="sdPretag1842980646sm" category="assay">qRT</sd-pretag>-<sd-pretag id="sdPretag685430748sm" category="assay">PCR</sd-pretag> (<em>n</em>=8/genotype).</p> <p>H <sd-pretag id="sdPretag2103299626sm" category="assay">Western blot</sd-pretag> of AUG-driven <sd-pretag id="sdPretag1872896014sm" type="geneprod" role="reporter">EGFP</sd-pretag> in <sd-pretag id="sdPretag29930970sm" type="geneprod" role="reporter">EGFP</sd-pretag>; <sd-pretag id="sdPretag183216997sm" type="geneprod" role="component">Tub5</sd-pretag>-GS <sd-pretag id="sdPretag2006740115sm" type="organism" role="component">flies</sd-pretag> with and without <em>belle</em> knockdown.</p> <p>I Quantitation of <sd-pretag id="sdPretag1268240374sm" type="geneprod" role="reporter">EGFP</sd-pretag> band density, normalized to β <sd-pretag id="sdPretag143977833sm" type="geneprod" role="assayed">tubulin</sd-pretag> band density, from blot in H <em>(n</em>=4/genotype)<em>.</em></p> <p>Data Information: For all panels, * P≤0.05, ** P≤0.01, *** P≤0.001, **** P≤0.0001 for the specified statistical <sd-pretag id="sdPretag1646702728sm" type="tissue" role="component">test</sd-pretag>. All data in all panels are presented as mean ± SD (compiled from ≥3 replicates).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=27035
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "45826",
"ext_tax_ids": "7227",
"ext_tax_names": "Drosophila melanogaster",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "45826",
"original_type": "gene",
"role": "intervention",
"text": "belle",
"type": "geneprod",
"uniprot_ids": [
"Q9VHP0",
"A0A0B4KGU4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "45826",
"ext_tax_ids": "7227",
"ext_tax_names": "Drosophila melanogaster",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "45826",
"original_type": "gene",
"role": "intervention",
"text": "belle",
"type": "geneprod",
"uniprot_ids": [
"Q9VHP0",
"A0A0B4KGU4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "45826",
"ext_tax_ids": "7227",
"ext_tax_names": "Drosophila melanogaster",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "45826",
"original_type": "gene",
"role": "intervention",
"text": "belle",
"type": "geneprod",
"uniprot_ids": [
"Q9VHP0",
"A0A0B4KGU4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "45826",
"ext_tax_ids": "7227",
"ext_tax_names": "Drosophila melanogaster",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "45826",
"original_type": "gene",
"role": "intervention",
"text": "belle",
"type": "geneprod",
"uniprot_ids": [
"Q9VHP0",
"A0A0B4KGU4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "31000",
"ext_tax_ids": "7227",
"ext_tax_names": "Drosophila melanogaster",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "31000",
"original_type": "gene",
"role": "intervention",
"text": "ElaV",
"type": "geneprod",
"uniprot_ids": [
"P16914",
"M9NFP7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q06787",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "FMR",
"type": "geneprod",
"uniprot_ids": [
"Q06787"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "45826",
"ext_tax_ids": "7227",
"ext_tax_names": "Drosophila melanogaster",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "45826",
"original_type": "gene",
"role": "intervention",
"text": "belle",
"type": "geneprod",
"uniprot_ids": [
"Q9VHP0",
"A0A0B4KGU4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "45826",
"ext_tax_ids": "7227",
"ext_tax_names": "Drosophila melanogaster",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "45826",
"original_type": "gene",
"role": "intervention",
"text": "belle",
"type": "geneprod",
"uniprot_ids": [
"Q9VHP0",
"A0A0B4KGU4"
]
}
] |
||
10.15252/embr.201847498
|
DDX3X and Specific Initiation Factors Modulate FMR1 Repeat-Associated Non-AUG Initiated translation
|
2019
|
Figure 3
|
<sd-panel> <p><strong>Figure 3. Knockdown of <sd-pretag id="sdPretag1668622231sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> Inhibits RAN Translation in Cultured <sd-pretag id="sdPretag782749662sm" type="organism" role="component">Human</sd-pretag> Cells.</strong></p> <p>A Dose-response <sd-pretag id="sdPretag1661853086sm" type="tissue" role="component">curves</sd-pretag> showing the effects of two independent anti-<sd-pretag id="sdPretag277534648sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> siRNAs on the expression of AUG-NL-3xF (top) and (CGG)<sub>100</sub> +1 NL-3xF (bottom) reporters. Plasmid-based reporters were transfected into <sd-pretag id="sdPretag1475319307sm" type="cell" role="component">HeLa</sd-pretag> cells 24 hours after knockdown, and reporter expression was quantified by luminescence. <sd-pretag id="sdPretag1090735304sm" type="geneprod" role="reporter">Nanoluciferase</sd-pretag> (NL) luminescence has been normalized to luminescence from <sd-pretag id="sdPretag1267592353sm" type="geneprod" role="reporter">firefly luciferase</sd-pretag> (FF), which was co-transfected, in order to control for transfection variability. Asterisks refer to comparisons between anti-<sd-pretag id="sdPretag1036394352sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> siRNAs and siRNAs against <sd-pretag id="sdPretag456380047sm" type="geneprod" role="reporter">EGFP</sd-pretag> (siEGFP; two-way ANOVA with Dunnett's multiple comparisons test; <em>n</em>=12/condition).</p> <p>B, C (CGG)<sub>n</sub> +1 and (CGG)<sub>n</sub> +2 <sd-pretag id="sdPretag1057641784sm" type="geneprod" role="assayed">NL-3xF</sd-pretag> expression (normalized to FF) with and without <sd-pretag id="sdPretag1155102629sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> knockdown across a range of CGG repeat sizes. Black asterisks refer to comparisons between siDDX3X- and siEGFP-treated cells; orange asterisks refer to comparisons between siDDX3X-treated cells expressing <sd-pretag id="sdPretag2049062970sm" type="geneprod" role="component">AUG</sd-pretag>-<sd-pretag id="sdPretag909748590sm" type="geneprod" role="intervention">NL-3xF</sd-pretag> and those expressing a different reporter (two-way ANOVA with Tukey's multiple comparisons test; <em>n</em>=17-30/condition).</p> <p>D, E <sd-pretag id="sdPretag1856287988sm" category="assay">Western blots</sd-pretag> of FMRpolyG-NL-3xF and FMRpolyA-NL-3xF products with and without <sd-pretag id="sdPretag1662843169sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> knockdown across a range of repeat sizes.</p> <p>Data Information: For all panels, * P≤0.05, ** P≤0.01, *** P≤0.001, **** P≤0.0001 for the specified statistical test. All panels depict data as means ± SD (compiled from ≥3 replicates).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=27036
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q06787",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "FMR",
"type": "geneprod",
"uniprot_ids": [
"Q06787"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q06787",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "FMR",
"type": "geneprod",
"uniprot_ids": [
"Q06787"
]
}
] |
||
10.15252/embr.201847498
|
DDX3X and Specific Initiation Factors Modulate FMR1 Repeat-Associated Non-AUG Initiated translation
|
2019
|
Figure 4
|
<sd-panel> <p><strong>Figure 4. DDX3X Facilitates Expression of <sd-pretag id="sdPretag508316366sm" type="geneprod" role="assayed">RAN</sd-pretag> Products at the Level of Translation.</strong></p> <p>A Expression of <em>in vitro</em> transcribed AUG, +1 (CGG)<sub>100</sub>, and +2 (CGG)<sub>100</sub> NL-3xF RNAs following <sd-pretag id="sdPretag1288899117sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> knockdown in <sd-pretag id="sdPretag2009721653sm" type="cell" role="component">HeLa</sd-pretag> cells, expressed as NL luminescence normalized to FF luminescence. (Student's t test with Bonferroni corrections for multiple comparisons; <em>n</em>=21/condition).</p> <p>B Abundance of reporter mRNAs following <sd-pretag id="sdPretag1216004997sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> knockdown and plasmid-reporter transfection, determined by <sd-pretag id="sdPretag933548523sm" category="assay">qRT</sd-pretag>-<sd-pretag id="sdPretag162789055sm" category="assay">PCR</sd-pretag>. (<em>n</em>=7/condition.) This panel depicts data as means ± SEM.</p> <p>C Expression of AUG-<sd-pretag id="sdPretag1018926671sm" type="geneprod" role="intervention">NL-3xF</sd-pretag> and +1 (CGG)<sub>100</sub> NL-3xF in <em>in vitro</em> translation extracts, collected from <sd-pretag id="sdPretag2135768557sm" type="cell" role="component">HeLa</sd-pretag> cells treated with siRNAs against <sd-pretag id="sdPretag541954399sm" type="geneprod" role="reporter">EGFP</sd-pretag> or <sd-pretag id="sdPretag367060613sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> (two-way ANOVA with Tukey's multiple comparisons test; <em>n</em>=4/condition).</p> <p>D Enrichment of <sd-pretag id="sdPretag962194374sm" type="geneprod" role="intervention"><em>HSPA1A</em></sd-pretag> and +1 (CGG)<sub>100</sub> NL-3xF mRNA following anti-<sd-pretag id="sdPretag1910292257sm" type="geneprod" role="intervention">DDX3X</sd-pretag> RIP, relative to incubation with isotype control IgG. <em>MALAT</em> RNA, in contrast, is not enriched (Student's t test, <em>n</em>=3). Data from the additional replicate is presented in Appendix Figure S8A.</p> <p>E Expression of +1 and +2 (CGG)<sub>100</sub> NL-3xF plasmid reporters with and without an AUG inserted 5' to the CGG repeat, with and without <sd-pretag id="sdPretag695698260sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> knockdown. Black asterisks refer to comparisons between siDDX3X- and siEGFP-treated cells; orange asterisks refer to comparisons between siDDX3X-treated cells expressing either +1 or +2 (CGG)<sub>100</sub> NL-3xF and those expressing the respective AUG-driven variant (two-way ANOVA with Tukey's multiple comparisons test; <em>n</em>=11-12/condition).</p> <p>F Expression of <sd-pretag id="sdPretag1315178046sm" type="geneprod" role="intervention">NL-3xF</sd-pretag> plasmids with <sd-pretag id="sdPretag689240916sm" type="molecule" role="component">initiator</sd-pretag> AUG codons mutated to near-AUG codons, with and without <sd-pretag id="sdPretag1663262176sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> knockdown (two-way ANOVA with Dunnett's multiple comparisons test; <em>n</em>=18-24/condition). Black asterisks refer to comparisons between siEGFP-treated and siDDX3X-treated cells; orange asterisks refer to comparisons between siDDX3X-treated cells expressing <sd-pretag id="sdPretag642797005sm" type="geneprod" role="component">AUG</sd-pretag>-<sd-pretag id="sdPretag1844228721sm" type="geneprod" role="intervention">NL-3xF</sd-pretag> and those expressing a different reporter; white asterisks refer to comparisons between siDDX3X-treated cells expressing +1 (CGG)<sub>100</sub> NL-3xF and those expressing a different reporter.</p> <p>G Expression of <em>in vitro</em> transcribed near-<sd-pretag id="sdPretag1482889560sm" type="geneprod" role="reporter">AUG</sd-pretag> reporter RNAs in <em>in vitro</em> translation extracts, collected from <sd-pretag id="sdPretag1860647847sm" type="cell" role="component">HeLa</sd-pretag> cells treated with siRNAs against <sd-pretag id="sdPretag1636271439sm" type="geneprod" role="reporter">EGFP</sd-pretag> or <sd-pretag id="sdPretag930061424sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag>. Experiments with independent, replicate lysates are presented in Appendix Figure S7C (<em>n</em>=4/group).</p> <p>Data Information: For all panels, ns=non-significant, *** P≤0.001, **** P≤0.0001 for the specified statistical <sd-pretag id="sdPretag135567105sm" type="tissue" role="component">test</sd-pretag>. All panels depict data as means ± SD, unless indicated otherwise (compiled from ≥3 replicates).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=27037
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "3303",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3303",
"original_type": "gene",
"role": "assayed",
"text": "HSPA1A",
"type": "geneprod",
"uniprot_ids": [
"P0DMV8",
"P0DMV9",
"A8K5I0",
"B3KTT5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "378938",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "unmapped",
"mapping_status": "unmapped",
"ncbi_gene_id": "378938",
"original_type": "gene",
"role": "assayed",
"text": "MALAT",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1654",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1654",
"original_type": "gene",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"O00571",
"A0A2R8YDT5",
"A0A2R8YFS5"
]
}
] |
||
10.15252/embr.201847498
|
DDX3X and Specific Initiation Factors Modulate FMR1 Repeat-Associated Non-AUG Initiated translation
|
2019
|
Figure 5
|
<sd-panel> <p><strong>Figure 5. <sd-pretag id="sdPretag550296914sm" type="geneprod" role="component"><em>EIF4B</em></sd-pretag> and <sd-pretag id="sdPretag1005320249sm" type="geneprod" role="intervention"><em>EIF4H</em></sd-pretag> Modulate <sd-pretag id="sdPretag947937145sm" type="organism" role="component">RAN</sd-pretag> Translation and General Translation in <sd-pretag id="sdPretag1061929531sm" type="organism" role="component"><em>Drosophila</em></sd-pretag> and Cultured <sd-pretag id="sdPretag1860903831sm" type="organism" role="component">Human</sd-pretag> Cells</strong>.</p> <p>A Representative photographs of <sd-pretag id="sdPretag498362488sm" type="geneprod" role="component">GMR</sd-pretag>-<sd-pretag id="sdPretag291869885sm" type="geneprod" role="component">GAL4</sd-pretag>; (<sd-pretag id="sdPretag1119755743sm" type="geneprod" role="intervention">CGG</sd-pretag>)<sub>90</sub>-<sd-pretag id="sdPretag1407619515sm" type="geneprod" role="reporter">EGFP</sd-pretag> fly <sd-pretag id="sdPretag1674450700sm" type="tissue" role="component">eyes</sd-pretag> expressing manipulations of <sd-pretag id="sdPretag1910059321sm" type="geneprod" role="assayed"><em>eIF4B</em></sd-pretag> and <sd-pretag id="sdPretag1916925176sm" type="geneprod" role="assayed"><em>eIF4H</em></sd-pretag>. (B) Quantitation of <sd-pretag id="sdPretag1700812366sm" type="geneprod" role="assayed">GMR</sd-pretag>-<sd-pretag id="sdPretag1121354173sm" type="geneprod" role="assayed">GAL4</sd-pretag>, (<sd-pretag id="sdPretag1458677730sm" type="geneprod" role="assayed">CGG</sd-pretag>)<sd-pretag id="sdPretag1924041876sm" type="geneprod" role="assayed"><sub>90</sub></sd-pretag>-<sd-pretag id="sdPretag1528301548sm" type="geneprod" role="reporter">EGFP</sd-pretag> eye phenotypes with <sd-pretag id="sdPretag839569910sm" type="geneprod" role="component"><em>eIF4B</em></sd-pretag>/<em>H</em> manipulations (Mann-Whitney U test with Bonferroni corrections for multiple comparisons; <em>n</em>=26-55/genotype).</p> <p>C, D Expression of plasmid-based AUG-NL and +1 (CGG)<sub>100</sub> NL-3xF reporters (C), or co-transfected AUG-FF reporters (D), following knockdown of <sd-pretag id="sdPretag1851033330sm" type="geneprod" role="intervention"><em>EIF4B</em></sd-pretag> or <sd-pretag id="sdPretag565885051sm" type="geneprod" role="intervention"><em>EIF4H</em></sd-pretag>. Black asterisks refer to comparisons between siEGFP- and <sd-pretag id="sdPretag791974184sm" type="geneprod" role="intervention">siEIF4B</sd-pretag>/H-treated cells; pink and blue asterisks refer to comparisons between <sd-pretag id="sdPretag761959339sm" type="geneprod" role="intervention">siEIF4B</sd-pretag>- (pink) or siEIF4H- (blue) treated cells expressing <sd-pretag id="sdPretag824372661sm" type="geneprod" role="reporter">AUG</sd-pretag>-<sd-pretag id="sdPretag528669091sm" type="geneprod" role="intervention">NL-3xF</sd-pretag> and those expressing +1 (<sd-pretag id="sdPretag925066218sm" type="cell" role="component">CGG</sd-pretag>)<sub>100</sub> (two-way ANOVA with Tukey's multiple comparisons test, <em>n</em>=9/condition).</p> <p>E Expression of plasmid-based AUG-NL-3xF and (<sd-pretag id="sdPretag1182795574sm" type="cell" role="component">CGG</sd-pretag>)<sub>100</sub> +1 <sd-pretag id="sdPretag1565889700sm" type="cell" role="component">NL-3xF</sd-pretag> reporters with and without over-expression of <sd-pretag id="sdPretag1919275788sm" type="geneprod" role="intervention"><em>EIF4B</em></sd-pretag>, <sd-pretag id="sdPretag153971765sm" type="geneprod" role="intervention"><em>EIF4H</em></sd-pretag>, or both (two-way ANOVA with Dunnett's multiple comparisons test; <em>n</em>=20/condition). Asterisks refer to comparisons between cells over-expressing either <sd-pretag id="sdPretag1255317280sm" type="geneprod" role="reporter">EGFP</sd-pretag> or <em><sd-pretag id="sdPretag1892249446sm" type="geneprod" role="intervention">EIF4B</sd-pretag>, <sd-pretag id="sdPretag1635851031sm" type="geneprod" role="intervention">EIF4H</sd-pretag>,</em> or <sd-pretag id="sdPretag1291900066sm" type="geneprod" role="intervention"><em>EIF4B</em></sd-pretag> and <sd-pretag id="sdPretag449574657sm" type="geneprod" role="intervention"><em>EIF4H</em></sd-pretag> and expressing the same reporter.</p> <p>Data Information: For all panels, ns=non-significant, * P≤0.05, ** P≤0.01, **** P≤0.0001 for the specified statistical test. All panels present data as means ± SD (compiled from ≥3 replicates).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=27038
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "3355041",
"ext_tax_ids": "7227",
"ext_tax_names": "Drosophila melanogaster",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3355041",
"original_type": "gene",
"role": "intervention",
"text": "eIF4B",
"type": "geneprod",
"uniprot_ids": [
"L7EEF1",
"Q7PLL1",
"Q7PLL3",
"Q8SYL3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "3355041",
"ext_tax_ids": "7227",
"ext_tax_names": "Drosophila melanogaster",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "3355041",
"original_type": "gene",
"role": "intervention",
"text": "eIF4B",
"type": "geneprod",
"uniprot_ids": [
"L7EEF1",
"Q7PLL1",
"Q7PLL3",
"Q8SYL3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "49809",
"ext_tax_ids": "7227",
"ext_tax_names": "Drosophila melanogaster",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "49809",
"original_type": "gene",
"role": "intervention",
"text": "eIF4H",
"type": "geneprod",
"uniprot_ids": [
"Q7KUX7",
"Q8IR13",
"Q9VXF8",
"X2JC79",
"X2JE34"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1975",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1975",
"original_type": "gene",
"role": "intervention",
"text": "EIF4B",
"type": "geneprod",
"uniprot_ids": [
"P23588",
"B4DRM3",
"E7EX17",
"Q7Z5Y0"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1975",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1975",
"original_type": "gene",
"role": "intervention",
"text": "EIF4B",
"type": "geneprod",
"uniprot_ids": [
"P23588",
"B4DRM3",
"E7EX17",
"Q7Z5Y0"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1975",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1975",
"original_type": "gene",
"role": "intervention",
"text": "EIF4B",
"type": "geneprod",
"uniprot_ids": [
"P23588",
"B4DRM3",
"E7EX17",
"Q7Z5Y0"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "7458",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "7458",
"original_type": "gene",
"role": "intervention",
"text": "EIF4H",
"type": "geneprod",
"uniprot_ids": [
"Q15056"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "7458",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "7458",
"original_type": "gene",
"role": "intervention",
"text": "EIF4H",
"type": "geneprod",
"uniprot_ids": [
"Q15056"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1975",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1975",
"original_type": "gene",
"role": "intervention",
"text": "EIF4B",
"type": "geneprod",
"uniprot_ids": [
"P23588",
"B4DRM3",
"E7EX17",
"Q7Z5Y0"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1975",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1975",
"original_type": "gene",
"role": "intervention",
"text": "EIF4B",
"type": "geneprod",
"uniprot_ids": [
"P23588",
"B4DRM3",
"E7EX17",
"Q7Z5Y0"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1975",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1975",
"original_type": "gene",
"role": "intervention",
"text": "EIF4B",
"type": "geneprod",
"uniprot_ids": [
"P23588",
"B4DRM3",
"E7EX17",
"Q7Z5Y0"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "7458",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "7458",
"original_type": "gene",
"role": "intervention",
"text": "EIF4H",
"type": "geneprod",
"uniprot_ids": [
"Q15056"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "7458",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "7458",
"original_type": "gene",
"role": "intervention",
"text": "EIF4H",
"type": "geneprod",
"uniprot_ids": [
"Q15056"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "7458",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "7458",
"original_type": "gene",
"role": "intervention",
"text": "EIF4H",
"type": "geneprod",
"uniprot_ids": [
"Q15056"
]
}
] |
||
10.15252/embr.201847498
|
DDX3X and Specific Initiation Factors Modulate FMR1 Repeat-Associated Non-AUG Initiated translation
|
2019
|
Figure 6
|
<sd-panel> <p><strong>Figure 6: <sd-pretag id="sdPretag1603045256sm" type="geneprod" role="assayed"><em>EIF1</em></sd-pretag> and <em><sd-pretag id="sdPretag1316234507sm" type="geneprod" role="component">EIF5</sd-pretag> m</em>odulate RAN translation by determining AUG start-codon specificity.</strong></p> <p>A Expression of plasmid-based <sd-pretag id="sdPretag1321795979sm" type="geneprod" role="component">NL-3xF</sd-pretag> reporters in <sd-pretag id="sdPretag131971689sm" type="cell" role="component">HEK293</sd-pretag> cells with and without over-expression of <sd-pretag id="sdPretag193094937sm" type="geneprod" role="intervention"><em>EIF1</em></sd-pretag> (two-way ANOVA with Sidak's multiple comparisons test; <em>n</em>=9-12/condition). Black asterisks refer to comparisons between Empty Vector-transfected and <sd-pretag id="sdPretag958593792sm" type="geneprod" role="intervention"><em>EIF1</em></sd-pretag>-transfected cells; green asterisks refer to comparisons between <sd-pretag id="sdPretag1764324568sm" type="geneprod" role="intervention"><em>EIF1</em></sd-pretag>-transfected cells expressing <sd-pretag id="sdPretag1428470086sm" type="geneprod" role="reporter">AUG</sd-pretag>-<sd-pretag id="sdPretag1606975589sm" type="geneprod" role="intervention">NL-3xF</sd-pretag> and those expressing a different reporter.</p> <p>B Expression of plasmid-based NL-3xF reporters in <sd-pretag id="sdPretag1836380932sm" type="cell" role="component">HEK293</sd-pretag> cells with and without over-expression of <sd-pretag id="sdPretag141622984sm" type="geneprod" role="intervention"><em>EIF5</em></sd-pretag> (two-way ANOVA with Sidak's multiple comparisons test; <em>n</em>=9-12/condition). Black asterisks refer to comparisons between Empty Vector-transfected and <sd-pretag id="sdPretag1434129345sm" type="geneprod" role="intervention"><em>EIF5</em></sd-pretag>-transfected cells; pink asterisks refer to comparisons between <sd-pretag id="sdPretag395015865sm" type="geneprod" role="intervention"><em>EIF5</em></sd-pretag>-transfected cells expressing <sd-pretag id="sdPretag499784049sm" type="geneprod" role="component">AUG</sd-pretag>-<sd-pretag id="sdPretag408670961sm" type="geneprod" role="intervention">NL-3xF</sd-pretag> and those expressing a different reporter. For all panels, *** P≤0.001, **** P≤0.0001 for the specified statistical test. Bars represent mean ± SEM (compiled from ≥3 replicates).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=27039
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "10209",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "10209",
"original_type": "gene",
"role": "intervention",
"text": "EIF1",
"type": "geneprod",
"uniprot_ids": [
"P41567",
"Q6IAV3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "10209",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "10209",
"original_type": "gene",
"role": "intervention",
"text": "EIF1",
"type": "geneprod",
"uniprot_ids": [
"P41567",
"Q6IAV3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "10209",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "10209",
"original_type": "gene",
"role": "intervention",
"text": "EIF1",
"type": "geneprod",
"uniprot_ids": [
"P41567",
"Q6IAV3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1983",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1983",
"original_type": "gene",
"role": "intervention",
"text": "EIF5",
"type": "geneprod",
"uniprot_ids": [
"P55010"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1983",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1983",
"original_type": "gene",
"role": "intervention",
"text": "EIF5",
"type": "geneprod",
"uniprot_ids": [
"P55010"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "1983",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "1983",
"original_type": "gene",
"role": "intervention",
"text": "EIF5",
"type": "geneprod",
"uniprot_ids": [
"P55010"
]
}
] |
||
10.15252/embr.201847498
|
DDX3X and Specific Initiation Factors Modulate FMR1 Repeat-Associated Non-AUG Initiated translation
|
2019
|
Figure 7
|
<sd-panel> <p><strong>Figure 7. Knockdown of <sd-pretag id="sdPretag589387707sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> Mitigates (CGG)<sub>100</sub> Toxicity in Primary Rodent <sd-pretag id="sdPretag927719484sm" type="cell" role="component">Neurons</sd-pretag>.</strong></p> <p>A Sample micrographs collected by automated longitudinal <sd-pretag id="sdPretag360624373sm" category="assay">fluorescence microscopy</sd-pretag>, demonstrating the automated determination of cell death.</p> <p>B Anti-<sd-pretag id="sdPretag1438639204sm" type="geneprod" role="intervention">DDX3X</sd-pretag> <sd-pretag id="sdPretag516867561sm" category="assay">western blot</sd-pretag> of <sd-pretag id="sdPretag1662730181sm" type="cell" role="component">B35</sd-pretag> cells transfected with either of two independent anti-<sd-pretag id="sdPretag1138276030sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> LNAs or a control <sd-pretag id="sdPretag4069834sm" type="molecule" role="component">LNA</sd-pretag>.</p> <p>C Expression of <sd-pretag id="sdPretag1708083499sm" type="geneprod" role="reporter">EGFP</sd-pretag> in primary rat <sd-pretag id="sdPretag1191317554sm" type="cell" role="component">neurons</sd-pretag> transfected with (CGG)<sub>100</sub> (+1) <sd-pretag id="sdPretag1046114241sm" type="geneprod" role="reporter">EGFP</sd-pretag> and either anti-<sd-pretag id="sdPretag360168200sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> LNAs or a control (one-way ANOVA with Tukey's multiple comparisons test; <em>n</em>=2408-5689 cells/condition). All graphs depict pooled data, normalized first within the replicate.</p> <p>D, E Transfection of anti-<sd-pretag id="sdPretag730136776sm" type="geneprod" role="intervention"><em>DDX3X</em></sd-pretag> LNA #1 (D) or #2 (E) reduced the cumulative risk of death in (CGG)<sub>100</sub> (+1) <sd-pretag id="sdPretag652080727sm" type="geneprod" role="reporter">EGFP</sd-pretag>-expressing <sd-pretag id="sdPretag1363810205sm" type="cell" role="component">neurons</sd-pretag> (Cox proportional hazard analysis; <em>n</em>=2408-3676 cells/condition).</p> <p>Data Information: For all panels, **** P≤0.0001 for the specified statistical test (compiled from ≥3 replicates).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=27040
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "A0A0G2K719",
"ext_tax_ids": "10116",
"ext_tax_names": "Rattus norvegicus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"A0A0G2K719"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "D4ADE8",
"ext_tax_ids": "10116",
"ext_tax_names": "Rattus norvegicus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"D4ADE8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "D4ADE8",
"ext_tax_ids": "10116",
"ext_tax_names": "Rattus norvegicus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"D4ADE8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "D4ADE8",
"ext_tax_ids": "10116",
"ext_tax_names": "Rattus norvegicus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "DDX3X",
"type": "geneprod",
"uniprot_ids": [
"D4ADE8"
]
}
] |
||
10.15252/embr.202050287
|
Scaf1 promotes respiratory supercomplexes and metabolic efficiency in zebrafish
|
2020
|
Figure 1
|
<sd-panel> <p><strong>Figure 1. OXPHOS super-assembly in zebrafish.</strong></p> <p><strong>A-D</strong>, Blue native gel electrophoresis <strong>(</strong>BNGdataE) of mouse (M) C57BL/6J (111), CD1 (113) and zebrafish (ZF) skeletal muscle digitonin-solubilized mitochondria. (<strong>A, B</strong>) Immunodetection of the indicated proteins after BNGE, (<strong>C</strong>) in-gel activity for CI and (<strong>D</strong>) CIV (shown is a representative gel from two technical and two biological replicates).</p> <p><strong>E-H</strong>, BNGE of whole-body zebrafish digitonin-solubilized mitochondria of <em>scaf1</em><sup>Δ1/Δ1</sup> (-/-) and its respective <em>scaf1</em><sup>+/+</sup> counterpart. (<strong>E, F</strong>) Immunodetection of the indicated proteins, (<strong>G</strong>) in-gel activity of CI and (<strong>H</strong>) CIV (representative gel from two technical and three biological replicates).</p> <p><strong>I</strong>, 2D BNGE/SDS electrophoresis: 1<sup>st</sup> dimension with digitonin (Dig) and 2<sup>nd</sup> dimension with SDS, followed by immunoblotting with the indicated antibodies to identify the proteins detected by the commercial anti-SCAF1 antibody. Asterisks indicate missing bands in <em>scaf1</em><sup>Δ1/Δ1</sup>.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=32965
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "I3ITF2",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SCAF1",
"type": "geneprod",
"uniprot_ids": [
"I3ITF2"
]
}
] |
||
10.15252/embr.202050287
|
Scaf1 promotes respiratory supercomplexes and metabolic efficiency in zebrafish
|
2020
|
Figure 2
|
<sd-panel> <p><strong>Figure 2. Blue-DiS proteomics of <em>scaf1</em><sup>+/+</sup> and <em>scaf1</em><sup>-/-</sup>.</strong></p> <p><strong>A</strong>, Quantitative data-independent scanning (DiS) mass spectrometry protein profiles for CI, CIII and CIV. Vertical numbers indicate the BNGE gel slices. Left and right profiles correspond to <em>scaf1</em><sup>+/+</sup> and <em>scaf1</em><sup>Δ1/Δ1</sup> animals, respectively. Red heatmap corresponds to the E-score from two proteotypic Scaf1-derived tryptic peptides spanning sequences ascribed to the CIII interacting site (in green) and to the CIV interacting site (in yellow). Thick blue line, marked with an asterisk, indicates the putative proteolytic site in Scaf1.</p> <p><strong>B</strong>, Sequence alignment of Scaf1 protein in mouse and zebrafish. Structural and functional regions previously described in mouse are indicated in shaded grey boxes. Thick blue line indicates the proteolytic processing site in the mouse sequence.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=32967
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "Scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "I3ITF2",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Scaf1",
"type": "geneprod",
"uniprot_ids": [
"I3ITF2"
]
}
] |
||
10.15252/embr.202050287
|
Scaf1 promotes respiratory supercomplexes and metabolic efficiency in zebrafish
|
2020
|
Figure 3
|
<sd-panel> <p><strong>Figure 3. Phenotype consequences of Scaf1 loss-of-function.</strong></p> <p><strong>A, B,</strong> Representative images from <em>scaf1</em><sup>+/+</sup> and <em>scaf1</em><sup>-/-</sup> (<strong>A</strong>) female and (<strong>B</strong>) male adult zebrafish.</p> <p><strong>c-f,</strong> Size of <em>scaf1</em><sup>Δ1/ Δ1</sup> and <em>scaf1</em><sup>Δ2/ Δ2</sup> (<em>scaf1</em><sup>-/-</sup>) fish in comparison with their respective <em>scaf1</em><sup>+/+</sup> lines, (<strong>C</strong>) length and (<strong>E</strong>) weight of females (Δ1 +/+ n=10, Δ1 -/- n=12, Δ2 +/+ n=24, Δ2 -/- n=18); (<strong>D</strong>) length and (<strong>F</strong>) weight of males (Δ1 +/+ n=16, Δ1 -/- n=13, Δ2 +/+ n=13, Δ2 -/- n=23).</p> <p><strong>G-K,</strong> Adipose tissue measurements on hematoxylin-eosin (H&E)-stained adult zebrafish sagittal sections. (<strong>G, I</strong>) Adipose tissue area per total section area (average of 3 sections/biological replicate) and (<strong>H, J</strong>) adipocyte size (average of 20-30 adipocytes of ventral adipose tissue per biological replicate) of females (<strong>G, H</strong>) (Δ1 n=8, Δ2 n=8, same number of animals for homozygous mutants and controls) and males (<strong>I, J</strong>)(Δ1 n=8, Δ2 n=7, same number of animals for homozygous mutants and controls). <strong>K,</strong> Representative images of ventral fat deposits in females (dotted lines).</p> <p><strong>L-N</strong>, Effect of Scaf1 loss of function on female fertility. (<strong>L</strong>) Number of eggs per clutch (Δ1 +/+ n=12, Δ1 -/- n=13, Δ2 +/+ n=13, Δ2 -/- n=10). (<strong>M</strong>) Quantification of mature ovary follicles per ovary section (average of three sections/biological replicate) (Δ1 n=5, Δ2 n=8; same number of animals for homozygous <em>scaf1</em><sup>+/+</sup> and <em>scaf1</em><sup>-/-</sup>). (<strong>N</strong>) Representative images of H&E-stained ovaries. Dotted lines delineate adipose tissue.</p> <p>Data information: One-way ANOVA. Outliers are shown in grey and were not considered for the statistical analysis. Data are represented as mean ± SD. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. Scale bars = 500 μm.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=32969
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "Scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
}
] |
||
10.15252/embr.202050287
|
Scaf1 promotes respiratory supercomplexes and metabolic efficiency in zebrafish
|
2020
|
Figure 4
|
<sd-panel> <p><strong>Figure 4. Scaf1 loss-of-function leads to alterations in mitochondrial structure and performance.</strong></p> <p><strong>A-C</strong>, Transmission electron microscopy image of cardiac muscle from <em>scaf1</em><sup>Δ1/Δ1</sup> (n=3) and <em>scaf1</em><sup>+/+</sup> fish (n=3). (<strong>A</strong>) Representative images showing mitochondria. (<strong>B</strong>) Mitochondria size (100-150 mitochondria per biological sample). (<strong>C</strong>) Cristae lumen width (average of three cristae per mitochondria, 20 mitochondria per biological sample). Different biological replicates are represented with different color tones.</p> <p><strong>D, E</strong>, Mitochondrial DNA copy number per nuclear copy number in muscle in females (<strong>D</strong>) and males (<strong>E</strong>) (Δ1 n=6, Δ2 n=6 and same number for their respective controls).</p> <p><strong>F</strong>, Survival curve of 4 days post-fertilization embryos treated with different concentrations of the indicated OXPHOS inhibitors (three experimental replicates per biological replicate and three biological replicates).</p> <p><strong>G, H</strong>, Oxygen consumption of 48 hours post-fertilization embryos using the XFe24 Seahorse analyzer, (<strong>G</strong>) Representative oxygen consumption rate (OCR) profile along time and (<strong>H</strong>) maximum OCR (Δ1 n=11, Δ2 n=11, n=10, n=11 respectively for their controls).</p> <p><strong>I</strong>, Maximum uncoupled (FCCP) OCR in isolated mitochondria from adult fish (male and females Δ1 n=4 and Δ2 n=4, and same number for their respective controls) with the indicated site I [pyruvate (Pyr), glutamate (Glu), malate (Mal)] or site II [succinate (Succ)] substrates.</p> <p><strong>J, K</strong>, Respiratory control ratio (RCR)(State 3/State4) (<strong>J</strong>) and P/O ratio (<strong>K</strong>) in isolated mitochondria from adult fish (male and females Δ1 n=4, and same number for their respective controls) with the indicated substrates.</p> <p>Data information: (<strong>B-E, G-H, J-K)</strong> Unpaired t-test, (<strong>F)</strong> two-way ANOVA, Sidak's multiple comparison test. (<strong>I)</strong> two-way ANOVA, post-hoc Fisher's LSD test. ns p>0.05, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. Data are represented as mean ± SD. Scale bars = large image 1 µm, small image 50 nm.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=32971
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
}
] |
||
10.15252/embr.202050287
|
Scaf1 promotes respiratory supercomplexes and metabolic efficiency in zebrafish
|
2020
|
Figure 5
|
<sd-panel> <p><strong>Figure 5. Diet-induced recovery of <em>scaf1</em><sup>-/-</sup> phenotypes</strong>.</p> <p>Data from females.</p> <p><strong>A</strong>, Representative images of <em>scaf1</em><sup>-/-</sup> and <em>scaf1</em><sup>+/+</sup> fish fed with the indicated diets.</p> <p><strong>B, C</strong>, Changes in (B) length and (<strong>C</strong>) weight over time (Δ1 +/+ n=10, Δ1 -/- n=10, Δ2 +/+ n=10, Δ2 -/- n=12-13.</p> <p><strong>D-F,</strong> Adipose tissue measurements on hematoxylin-eosin (H&E)-stained adult zebrafish sagittal sections. (<strong>D</strong>) Adipose tissue area per total section area (average of three sections/biological replicate) and (<strong>E</strong>) adipocyte size (average of 20-30 adipocytes of ventral adipose tissue per biological replicate) (Δ1 +/+ n=3, Δ2 n=8). <em>scaf1</em><sup>Δ1</sup> and <em>scaf1</em><sup>Δ2</sup> are represented with circles and squares, respectively. (<strong>F</strong>) Representative images of ventral fat deposits (dotted lines).</p> <p><strong>G</strong>, Number of eggs per clutch (standard diet Δ1 +/+ n=8, Δ1 -/- n=8, Δ2 +/+ n=7, Δ2 -/- n=12, double diet Δ1 +/+ n=7, Δ1 -/- n=8, Δ2 +/+ n=8, Δ2 -/- n=9).</p> <p><strong>H</strong>, Representative images of H&E-stained ovaries. Black dotted lines outline the ovaries, blue dotted line indicates a mature follicle.</p> <p><strong>I</strong>, Quantification of mature ovary follicles per ovary section (average of three sections/biological sample) (Δ1 n=2-3, Δ2 n=6).</p> <p><strong>Data information: (B, C</strong>) Two-way ANOVA, (<strong>D, I</strong>) unpaired t-test, (<strong>E, G</strong>) one-way ANOVA. Data are represented as mean ± SD. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. Scale bars = 500 μm.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=32973
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
}
] |
||
10.15252/embr.202050287
|
Scaf1 promotes respiratory supercomplexes and metabolic efficiency in zebrafish
|
2020
|
Figure 6
|
<sd-panel> <p><strong>Figure 6. Lack of recovery of Scaf1<sup>-/-</sup> phenotypes after high-fat diet.</strong></p> <p><strong>A, B,</strong> Representative images of <em>scaf1</em><sup>-/-</sup> and <em>scaf1</em><sup>+/+</sup> females (<strong>A</strong>) and males (<strong>B</strong>) fed with the indicated diets.</p> <p><strong>C, D,</strong> Length of females (<strong>C</strong>) and males (D) after the indicated diets (Δ1 +/+ n=5, Δ1 -/- n=5, Δ2 +/+ n=5, Δ2 -/- n=5).</p> <p><strong>E, F,</strong> Weight of females (<strong>E</strong>) and males (<strong>F</strong>) after the indicated diets (Δ1 +/+ n=5, Δ1 -/- n=5, Δ2 +/+ n=5, Δ2 -/- n=5).</p> <p><strong>G</strong>, number of eggs per clutch (standard diet: Δ1 +/+ n=4, Δ1 -/- n=3, Δ2 +/+ n=3, Δ2 -/- n=2, double diet: Δ1 +/+ n=5, Δ1 -/-, n=5 Δ2 +/+ n=1, Δ2 -/- n=2).</p> <p><strong>H,</strong> Quantification of mature ovary follicles per ovary section in haematoxylin-eosin (H&E) histological sections (average of three sections/biological sample) (Δ1 n=3, Δ2 n=3).</p> <p><strong>I-L</strong>, adipose tissue quantification in H&E sections (Δ1 n=3, Δ2 n=3) in females (<strong>I, K</strong>) and males (J<strong>, L</strong>): adipose tissue area (<strong>I, J</strong>) and adipocyte size (<strong>K, L</strong>).</p> <p>Data information: (<strong>C-F)</strong> two-way ANOVA. (<strong>G-L)</strong> unpaired t-test. Data are represented as mean ± SD. ns p>0.05, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=32975
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
}
] |
||
10.15252/embr.202050287
|
Scaf1 promotes respiratory supercomplexes and metabolic efficiency in zebrafish
|
2020
|
Figure 7
|
<sd-panel> <p><strong>Figure 7. Molecular basis for diet-induced recovery of <em>scaf1</em><sup>-/-</sup> phenotypes.</strong></p> <p><strong>A,</strong> Immunoblot of the indicated proteins of BNGE from female <em>scaf1</em><sup>+/+</sup> and <em>scaf1</em><sup>-/-</sup> whole zebrafish mitochondria for the indicated diet (representative of n=2).</p> <p><strong>B,</strong> Maximum uncoupled (FCCP) oxygen consumption rate in whole zebrafish mitochondria (females Δ1 n=4 and Δ2 n=4, and same number for their respective controls) with glutamate (Glu), malate (Mal) and succinate (Succ).</p> <p><strong>C-G,</strong> RNAseq data from <em>scaf1</em><sup>+/+</sup> and <em>scaf1</em><sup>-/-</sup> skeletal muscle for the indicated diet (standard diet <em>scaf1</em><sup>+/+</sup> and <em>scaf1</em><sup>-/-</sup> n=4, double diet <em>scaf1</em><sup>+/+</sup> n=3, <em>scaf1</em><sup>-/-</sup> n=4). (<strong>C-F)</strong> Volcano plots of differentially expressed genes (DEGs). (<strong>C</strong>) Comparison between <em>scaf1</em><sup>-/-</sup> and <em>scaf1</em><sup>+/+</sup> zebrafish in standard diet. (<strong>D</strong>) Comparison between <em>scaf1</em><sup>-/-</sup> and <em>scaf1</em><sup>+/+</sup> zebrafish in double diet. (<strong>E</strong>) Comparison of <em>scaf1</em><sup>+/+</sup> zebrafish in double diet and standard diet. (<strong>F</strong>) Comparison of <em>scaf1</em><sup>-/-</sup> zebrafish in double diet and standard diet. In blue, significant DEGs (p-adj < 0.05, log<sub>2</sub>FC > |1|), in grey not significant DEGs, red circles represent non-significant differentially regulated OXPHOS genes, green circles represent significant differentially regulated OXPHOS genes, purple <em>scaf1</em> (<em>cox7a2l</em>). (<strong>G</strong>) Heatmap of metabolic differentially regulated pathways in Gene Set Enrichment Analysis (GSEA) in the indicated comparisons.</p> <p>(<strong>H</strong>) Heatmap of differentially regulated growth Hallmarks in GSEA in the indicated comparisons.</p> <p><strong>Data information: (G-H)</strong> White squares padj>0.05, colored squares padj<0.05, in blue downregulated gene sets, in red upregulated gene sets. (<strong>B</strong>) T-test analysis. Data are represented as mean ± SD. * p<0.05, *** p<0.001.</p> <p><strong>EXPANDED VIEW FIGURE LEGENDS</strong></p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=32976
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "335751",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "335751",
"original_type": "gene",
"role": "assayed",
"text": "cox7a2l",
"type": "geneprod",
"uniprot_ids": [
"Q7SXI1"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "553490",
"ext_tax_ids": "7955",
"ext_tax_names": "Danio rerio",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "553490",
"original_type": "gene",
"role": "intervention",
"text": "scaf1button type=\"button\" class=\"btn btn-success btn-xs\" ng-click=\"confirmPretag(true,'p",
"type": "geneprod",
"uniprot_ids": [
"A0A8M2BBI6",
"I3ITF2"
]
}
] |
||
10.15252/embj.2019103208
|
Neurexins cluster Ca2+ channels within the presynaptic active zone
|
2020
|
Figure 1
|
<sd-panel> <p><strong>Figure 1. Neurexins are not required for synapse formation at the calyx of Held</strong></p> <p>A. Diagram of the calyx of Held synapse.</p> <p>B. Strategy for selective deletion of all neurexins at the Calyx of Held by crossing PV-Cre driver mice with neurexin-1/2/3 (Nrxn123) triple conditional knockout (TKO) mice (Zhang et al., 2016; Chen et al., 2017).</p> <p>C. Representative images of calyx synapses from littermate control and Nrxn123 TKO mice. Brainstem sections were labeled with antibodies to vGluT1 (red) and Syt2 (green). Scale bar, 10 μm.</p> <p>D. Summary graphs of the synaptic vGluT1 and Syt2 immunostaining intensity (normalized to control).</p> <p>E-H. Representative traces of spontaneous EPSCs (sEPSCs)(E), and summary graphs of the sEPSC frequency (F), amplitude (G), and kinetics (H) recorded from littermate control and Nrxn123 TKO mice.</p> <p>Data information: Data in (D, F-H) are means ± SEM with individual data points. Number of image sections/mice (D) or of cells from at least three mice per group (F-H) analyzed are indicated in the bars. No statistical differences were found by Student's t-test.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=30150
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "18189",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "18189",
"original_type": "gene",
"role": "intervention",
"text": "Nrxn1",
"type": "geneprod",
"uniprot_ids": [
"P0DI97",
"Q9CS84",
"A0A0H2UH29",
"E0CY11",
"E0CZA5",
"G3UWQ9"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3TXX4",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "vGluT1",
"type": "geneprod",
"uniprot_ids": [
"Q3TXX4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3TXX4",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "vGluT1",
"type": "geneprod",
"uniprot_ids": [
"Q3TXX4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P46097",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Syt2",
"type": "geneprod",
"uniprot_ids": [
"P46097"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P46097",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Syt2",
"type": "geneprod",
"uniprot_ids": [
"P46097"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "18189",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "18189",
"original_type": "gene",
"role": "intervention",
"text": "Nrxn1",
"type": "geneprod",
"uniprot_ids": [
"P0DI97",
"Q9CS84",
"A0A0H2UH29",
"E0CY11",
"E0CZA5",
"G3UWQ9"
]
}
] |
||
10.15252/embj.2019103208
|
Neurexins cluster Ca2+ channels within the presynaptic active zone
|
2020
|
Figure 2
|
<sd-panel> <p><strong>Figure 2. Pan-neurexin deletion severely impairs evoked synaptic transmission at calyx synapses</strong> All experiments were carried out in acute MNTB slices from littermate control and Nrxn123 TKO mice at P12-14. EPSCs were evoked by afferent fiber stimulation and recorded in postsynaptic whole-cell patch clamp mode.</p> <p>A. Representative traces of EPSCs evoked by paired stimuli separated by 10 ms and repeated every 20 s, recorded in a standard bath solution containing 2 mM Ca<sup>2+</sup>.</p> <p>B. Pan-neurexin deletion suppresses synaptic transmission. Summary graphs show the amplitude (left) and charge transfer (right) of the first EPSC recorded in response to the paired stimuli.</p> <p>C. Pan-neurexin deletion more than doubles the paired-pulse ratio (PPR), suggesting a large decrease in release probability.</p> <p>D. Pan-neurexin deletion decelerates the EPSC time course. Summary graphs show the rise time (left) and decay time constants (right) of the first EPSC in response to the paired stimuli.</p> <p>E-F. Pan-neurexin deletion does not significantly alter the cumulative EPSC amplitude during a high-frequency stimulus train (100 Hz for 0.5 sec). Left, representative ESPC traces; right, cumulative summary plot of the EPSC amplitudes during the train (dotted lines show linear regression fits for estimating the cumulative EPSC amplitude by back-extrapolation to zero time, which is used to correct for vesicle replenishment during the train).</p> <p>G. Pan-neurexin deletion does not decrease the readily-releasable pool of vesicles, but lowers the initial release probability during a high-frequency stimulus train. Summary graphs show the cumulative EPSC amplitudes extrapolated to time zero as an estimate of the readily-releasable pool size (left), and the ratio of the first EPSC amplitude divided by the cumulative EPSC amplitudes extrapolated to time zero as an estimate of the initial release probability (right).</p> <p>Data information: Data are means ± SEM with individual data points. Number of cells (from at least three mice per group) analyzed are indicated in the bars (B, D, and G) or in the graph (F) and apply to all graphs in a series; statistical differences were assessed by Student's t-test (**P < 0.01;***P < 0.001; non-significant differences are not marked).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=30152
|
[
{
"ext_dbs": "NCBI gene///NCBI gene///NCBI gene",
"ext_ids": "18191///18190///18189",
"ext_tax_ids": "10090///10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "gene",
"role": "intervention",
"text": "neurexin",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene///NCBI gene///NCBI gene",
"ext_ids": "18191///18190///18189",
"ext_tax_ids": "10090///10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "gene",
"role": "intervention",
"text": "neurexin",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene///NCBI gene///NCBI gene",
"ext_ids": "18191///18190///18189",
"ext_tax_ids": "10090///10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "gene",
"role": "intervention",
"text": "neurexin",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene///NCBI gene///NCBI gene",
"ext_ids": "18191///18190///18189",
"ext_tax_ids": "10090///10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "gene",
"role": "intervention",
"text": "neurexin",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene///NCBI gene///NCBI gene",
"ext_ids": "18191///18190///18189",
"ext_tax_ids": "10090///10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "gene",
"role": "intervention",
"text": "neurexin",
"type": "geneprod",
"uniprot_ids": []
}
] |
||
10.15252/embj.2019103208
|
Neurexins cluster Ca2+ channels within the presynaptic active zone
|
2020
|
Figure 4
|
<sd-panel> <p><strong>Figure 4. Deletion of all neurexins from the calyx of Held synapse does not alter the size or properties of presynaptic Ca<sup>2+</sup>-currents</strong></p> <p>A. Example traces of presynaptic Ca<sup>2+</sup>-currents recorded in patched calyx terminals as induced by a 50 ms step depolarization from −50 mV to +40 mV in 10 mV increments at a holding potential of −80 mV.</p> <p>B. Summary graphs of the I-V relationship for the peak Ca<sup>2+</sup>-current amplitude (left) and of the peak Ca<sup>2+</sup>-current density (right).</p> <p>C. Example traces (left) and summary graphs (right) of the Ca<sup>2+</sup>-current activation and deactivation kinetics. Currents were induced by a 50 ms step depolarization from -80 mV to +10 mV.</p> <p>D. Example traces of Ca<sup>2+</sup>-currents evoked by an action potential-equivalent depolarization (AP<sub>e</sub>, from -80 mV to +17 mV for 1 ms; left), and summary graph of the AP<sub>e</sub>-evoked Ca<sup>2+</sup>-current peak amplitude and charge (right).</p> <p>E. Example traces of presynaptic Ca<sup>2+</sup>-currents induced by a 50 ms step depolarization from −50 mV to +40 mV in 10 mV increments at a holding potential of −80 mV before and after perfusion of 200 nM agatoxin (Agtx), a selective P/Q-type Ca<sup>2+</sup> channel blocker.</p> <p>F. Summary graph of the relative contribution of P/Q-type Ca<sup>2+</sup> channels to the total presynaptic Ca<sup>2+</sup> currents, as quantified by the relative reduction in Ca<sup>2+</sup> currents evoked by step depolarization to +10 mV, in control and Nrxn123 TKO synapses.</p> <p>Data information: Data in (B-D, F) are means ± SEM. Number of cells (from three mice per group) analyzed are indicated in the graph (B) or in the bars (C, D and F); no statistically significant differences were observed as assessed by Student's t-test.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=30156
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P97445",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "P/Q-type Ca2+ channel",
"type": "geneprod",
"uniprot_ids": [
"P97445"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "18189",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "18189",
"original_type": "gene",
"role": "intervention",
"text": "Nrxn1",
"type": "geneprod",
"uniprot_ids": [
"P0DI97",
"Q9CS84",
"A0A0H2UH29",
"E0CY11",
"E0CZA5",
"G3UWQ9"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P97445",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "P/Q-type Ca2+ channels",
"type": "geneprod",
"uniprot_ids": [
"P97445"
]
}
] |
||
10.15252/embj.2019103208
|
Neurexins cluster Ca2+ channels within the presynaptic active zone
|
2020
|
Figure 6
|
<sd-panel> <p><strong>Figure 6. Pan-neurexin deletion depletes K<sup>+</sup>-currents carried by presynaptic BK-channels in the calyx of Held synapse</strong></p> <p>A. Representative traces of Ca<sup>2+</sup>-currents and 4-AP insensitive K<sup>+</sup>-currents evoked by step depolarizations (from −50 mV to +10 mV in 10 mV increments), recorded from the calyx terminals in acute slices from littermate control and Nrxn123 TKO mice at P12-P14.</p> <p>B. Same as (A) but after addition of 200 nM iberiotoxin (IbTx) by perfusion.</p> <p>C. Representative traces of presynaptic BK currents, which are calculated by subtracting currents shown in (B) from currents shown in (A).</p> <p>D. Summary graphs of the capacitance, Ca<sup>2+</sup>-current density, and BK-current density.</p> <p>Data information: Data are means ± SEM with individual data points. Number of cells (from at least three mice per group) analyzed are indicated in the bars (D); Statistical differences were assessed by Student's t test. (**P < 0.01)</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=30160
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "18189",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "18189",
"original_type": "gene",
"role": "intervention",
"text": "Nrxn1",
"type": "geneprod",
"uniprot_ids": [
"P0DI97",
"Q9CS84",
"A0A0H2UH29",
"E0CY11",
"E0CZA5",
"G3UWQ9"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q08460",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BK",
"type": "geneprod",
"uniprot_ids": [
"Q08460"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q08460",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BK",
"type": "geneprod",
"uniprot_ids": [
"Q08460"
]
}
] |
||
10.15252/embj.2019103208
|
Neurexins cluster Ca2+ channels within the presynaptic active zone
|
2020
|
Figure 7
|
<sd-panel> <p><strong>Figure 7. Pan-neurexin deletion depletes Ca<sub>V</sub>2.1-type Ca<sup>2+</sup>-channels and Bassoon from the presynaptic active zone of the calyx of Held</strong></p> <p>A. Representative images of brainstem cryosections stained by triple immunofluorescence labeling for vGluT1 (green), Ca<sub>V</sub>2.1-type Ca<sup>2+</sup>-channels (red), and the active zone protein Bassoon (purple). Cryosections were obtained from littermate control and Nrxn123 TKO mice at P12-14. Scale bar, 10 μm.</p> <p>B. Summary graphs of the vGluT1, Ca<sub>V</sub>2.1, and Bassoon immunostaining intensity (normalized to control; Ca<sub>V</sub>2.1 and Bassoon signals were quantified over the vGluT1-positive area to measure active zone-localized proteins).</p> <p>C. Summary graphs of the diameter and total size of the vGluT1-positive presynaptic area of the calyx of Held.</p> <p>Data information: Data are means ± SEM with individual data points. Number of brain sections and mice analyzed are indicated in the bars (B and C); statistical differences were assessed by Student's t-test (***P < 0.001).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=30161
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "18189",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "18189",
"original_type": "gene",
"role": "intervention",
"text": "Nrxn1",
"type": "geneprod",
"uniprot_ids": [
"P0DI97",
"Q9CS84",
"A0A0H2UH29",
"E0CY11",
"E0CZA5",
"G3UWQ9"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O88737",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Bassoon",
"type": "geneprod",
"uniprot_ids": [
"O88737"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P97445",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "CaV2.1-type Ca2+-channels",
"type": "geneprod",
"uniprot_ids": [
"P97445"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3TXX4",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "vGluT1",
"type": "geneprod",
"uniprot_ids": [
"Q3TXX4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O88737",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Bassoon",
"type": "geneprod",
"uniprot_ids": [
"O88737"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O88737",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Bassoon",
"type": "geneprod",
"uniprot_ids": [
"O88737"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P97445",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "CaV2.1",
"type": "geneprod",
"uniprot_ids": [
"P97445"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P97445",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "CaV2.1",
"type": "geneprod",
"uniprot_ids": [
"P97445"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3TXX4",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "vGluT1",
"type": "geneprod",
"uniprot_ids": [
"Q3TXX4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3TXX4",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "vGluT1",
"type": "geneprod",
"uniprot_ids": [
"Q3TXX4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3TXX4",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "vGluT1",
"type": "geneprod",
"uniprot_ids": [
"Q3TXX4"
]
}
] |
||
22820375
|
10.1038/ncb2536
|
Modulation of glutamine metabolism by the PI(3)K–PKB–FOXO network regulates autophagy
|
2012
|
figf1
|
<p>(<b>a</b>) Ba/F3 cells expressing myrPI(3)K-ER, myrPKB-ER, <named-entity id="named-entity-415">FOXO3</named-entity>(A3)-ER or <named-entity id="named-entity-416">FOXO4</named-entity>(A3)-ER were stimulated with <named-entity id="named-entity-417">4-OHT</named-entity> for 4 h (myrPI(3)K-ER, myrPKB-ER) or 8 h (<named-entity id="named-entity-418">FOXO3</named-entity>(A3)-ER and <named-entity id="named-entity-419">FOXO4</named-entity>(A3)-ER) and microarray analyses were performed. Shown are the fold changes relative to control cells for <named-entity id="named-entity-420">glutamine synthetase</named-entity> (<named-entity id="named-entity-421">GS</named-entity>), <named-entity id="named-entity-422">Mxi1</named-entity> and <named-entity id="named-entity-423">Pink1</named-entity>. Data are represented as mean values of one experiment performed in quadruplicate. (<b>b</b>) Ba/F3 cells expressing either myrPI(3)K-ER or myrPKB-ER were cytokine starved overnight and stimulated with <named-entity id="named-entity-424">4-OHT</named-entity>. Relative mRNA levels of <named-entity id="named-entity-425">glutamine synthetase</named-entity> were analysed using quantitative rtPCR. Data are represented as mean ± s.e.m. normalized for B<sub>2</sub>M (<i>n</i>=4).
<super>*</super><i>P</i>0.05,
<super>**</super><i>P</i>0.01. (<b>c</b>) Ba/F3 cells expressing either myrPI(3)K-ER or myrPKB-ER were cytokine starved overnight and stimulated with <named-entity id="named-entity-426">4-OHT</named-entity>. Cell lysates were analysed for protein levels of phospho-<named-entity id="named-entity-427">FOXO3</named-entity> (T32), <named-entity id="named-entity-428">glutamine synthetase</named-entity>, <named-entity id="named-entity-429">p27</named-entity> and actin. Shown are representative blots (<i>n</i>=4). (<b>d</b>) Ba/F3 cells expressing either <named-entity id="named-entity-430">FOXO3</named-entity>(A3)-ER or <named-entity id="named-entity-431">FOXO4</named-entity>(A3)-ER were stimulated with <named-entity id="named-entity-432">4-OHT</named-entity> in the presence of <named-entity id="named-entity-433">mIL-3</named-entity>. Relative mRNA levels of <named-entity id="named-entity-434">glutamine synthetase</named-entity> were analysed using quantitative rtPCR. Data are represented as mean ± s.e.m. values normalized for B<sub>2</sub>M (<i>n</i>=3).
<super>**</super><i>P</i>0.01. (<b>e</b>) Ba/F3 cells expressing either <named-entity id="named-entity-435">FOXO3</named-entity>(A3)-ER or <named-entity id="named-entity-436">FOXO4</named-entity>(A3)-ER were stimulated with <named-entity id="named-entity-437">4-OHT</named-entity> in the presence of <named-entity id="named-entity-438">mIL-3</named-entity>. Cell lysates were analysed for protein levels of <named-entity id="named-entity-439">glutamine synthetase</named-entity>, <named-entity id="named-entity-440">p27</named-entity> and actin. Shown are representative blots (<i>n</i>=3). (<b>f</b>) Wild-type Ba/F3 cells were cytokine starved overnight and stimulated with <named-entity id="named-entity-441">mIL-3</named-entity>. Cell lysates were analysed for protein levels of phospho-<named-entity id="named-entity-442">FOXO3</named-entity> (T32), <named-entity id="named-entity-443">glutamine synthetase</named-entity>, <named-entity id="named-entity-444">p27</named-entity> and actin. Shown are representative blots (<i>n</i>=4). (<b>g</b>) Wild-type Ba/F3 cells were incubated with <named-entity id="named-entity-445">LY294002</named-entity> in the presence of <named-entity id="named-entity-446">mIL-3</named-entity>. Cell lysates were analysed for protein levels of <named-entity id="named-entity-447">glutamine synthetase</named-entity>, <named-entity id="named-entity-448">p27</named-entity> and actin. Shown are representative blots (<i>n</i>=3). (<b>h</b>)
<i>F</i><i>O</i><i>X</i><i>O</i><i>1,3,4</i><super>−/−</super> MEFs and wild-type MEFs were incubated with <named-entity id="named-entity-449">LY294002</named-entity> (10 μM) for the indicated times. Cell RNA was isolated and relative mRNA levels of <named-entity id="named-entity-450">glutamine synthetase</named-entity> were analysed using quantitative PCR. Data are represented as mean values normalized for B<sub>2</sub>M (<i>n</i>=2). Uncropped images of blots are shown in <sir rid="s1" refobjid="ncb2536-s1">Supplementary Fig. S7</sir>.</p>
|
https://api.sourcedata.io/file.php?figure_id=3042
|
[
{
"ext_dbs": "NCBI gene///NCBI gene",
"ext_ids": "11651///11652",
"ext_tax_ids": "10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "gene",
"role": "intervention",
"text": "PKB",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "56484",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "56484",
"original_type": "gene",
"role": "intervention",
"text": "FOXO3",
"type": "geneprod",
"uniprot_ids": [
"Q9WVH4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "56484",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "56484",
"original_type": "gene",
"role": "intervention",
"text": "FOXO3",
"type": "geneprod",
"uniprot_ids": [
"Q9WVH4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54601",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54601",
"original_type": "gene",
"role": "intervention",
"text": "FOXO4",
"type": "geneprod",
"uniprot_ids": [
"Q9WVH3",
"B1AUT3",
"Q4KL34"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54601",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54601",
"original_type": "gene",
"role": "intervention",
"text": "FOXO4",
"type": "geneprod",
"uniprot_ids": [
"Q9WVH3",
"B1AUT3",
"Q4KL34"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "14645",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "14645",
"original_type": "gene",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "17859",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "17859",
"original_type": "gene",
"role": "assayed",
"text": "Mxi1",
"type": "geneprod",
"uniprot_ids": [
"P50540",
"Q3U3X2",
"Q3USD3",
"Q6P2L3"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "18706",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "18706",
"original_type": "gene",
"role": "intervention",
"text": "PI(3)K",
"type": "geneprod",
"uniprot_ids": [
"P42337"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "68943",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "68943",
"original_type": "gene",
"role": "assayed",
"text": "Pink1",
"type": "geneprod",
"uniprot_ids": [
"Q99MQ3"
]
},
{
"ext_dbs": "NCBI gene///NCBI gene",
"ext_ids": "11651///11652",
"ext_tax_ids": "10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "gene",
"role": "intervention",
"text": "PKB",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "14645",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "14645",
"original_type": "gene",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "18706",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "18706",
"original_type": "gene",
"role": "intervention",
"text": "PI(3)K",
"type": "geneprod",
"uniprot_ids": [
"P42337"
]
},
{
"ext_dbs": "NCBI gene///NCBI gene",
"ext_ids": "11651///11652",
"ext_tax_ids": "10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "gene",
"role": "intervention",
"text": "PKB",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "18706",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "18706",
"original_type": "gene",
"role": "intervention",
"text": "PI(3)K",
"type": "geneprod",
"uniprot_ids": [
"P42337"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P46414",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "p27",
"type": "geneprod",
"uniprot_ids": [
"P46414"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9WVH4",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "FOXO3",
"type": "geneprod",
"uniprot_ids": [
"Q9WVH4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15105",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "56484",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "56484",
"original_type": "gene",
"role": "intervention",
"text": "FOXO3",
"type": "geneprod",
"uniprot_ids": [
"Q9WVH4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54601",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54601",
"original_type": "gene",
"role": "intervention",
"text": "FOXO4",
"type": "geneprod",
"uniprot_ids": [
"Q9WVH3",
"B1AUT3",
"Q4KL34"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "14645",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "14645",
"original_type": "gene",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "56484",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "56484",
"original_type": "gene",
"role": "intervention",
"text": "FOXO3",
"type": "geneprod",
"uniprot_ids": [
"Q9WVH4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "54601",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "54601",
"original_type": "gene",
"role": "intervention",
"text": "FOXO4",
"type": "geneprod",
"uniprot_ids": [
"Q9WVH3",
"B1AUT3",
"Q4KL34"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P46414",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "p27",
"type": "geneprod",
"uniprot_ids": [
"P46414"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15105",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P46414",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "p27",
"type": "geneprod",
"uniprot_ids": [
"P46414"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9WVH4",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "FOXO3",
"type": "geneprod",
"uniprot_ids": [
"Q9WVH4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15105",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P01586",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "IL-3",
"type": "geneprod",
"uniprot_ids": [
"P01586"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P46414",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "p27",
"type": "geneprod",
"uniprot_ids": [
"P46414"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15105",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "56458",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "56458",
"original_type": "gene",
"role": "intervention",
"text": "FOXO1",
"type": "geneprod",
"uniprot_ids": [
"Q9R1E0"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "14645",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "14645",
"original_type": "gene",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
}
] |
|
22820375
|
10.1038/ncb2536
|
Modulation of glutamine metabolism by the PI(3)K–PKB–FOXO network regulates autophagy
|
2012
|
figf2
|
<p>(<b>a</b>) Ba/F3 cells expressing <named-entity id="named-entity-452">FOXO3</named-entity>(A3)-ER were stimulated with <named-entity id="named-entity-453">4-OHT</named-entity> and <named-entity id="named-entity-454">actinomycin D</named-entity> (1 μg ml<super>−1</super>) or <named-entity id="named-entity-455">dimethylsulphoxide</named-entity> (<named-entity id="named-entity-456">DMSO</named-entity>) as a control in the presence of <named-entity id="named-entity-457">mIL-3</named-entity> for 16 h. Cell lysates were analysed for protein levels of <named-entity id="named-entity-458">glutamine synthetase</named-entity> (<named-entity id="named-entity-459">GS</named-entity>), <named-entity id="named-entity-460">p27</named-entity> and actin. Shown are representative blots (<i>n</i>=3). (<b>b</b>) <named-entity id="named-entity-461">Glutamine synthetase</named-entity> reporter plasmids carrying mutations in putative FOXO-binding sites were transfected in HEK293 cells together with Renilla and <named-entity id="named-entity-462">FOXO3</named-entity>(A3) as indicated. Luciferase activity was measured 40 h after transfection. Data are depicted as relative luciferase units (RLU) compared with the control. Shown are mean ± s.e.m. values (<i>n</i>=3). (<b>c</b>) HEK293 cells were stimulated with <named-entity id="named-entity-463">LY294002</named-entity> for 24 h and chromatin immunoprecipitations were performed. Protein–DNA complexes were <named-entity id="named-entity-464">formaldehyde</named-entity>-crosslinked, and chromatin fragments from these cells were subjected to immunoprecipitation with a control antibody or antibodies against <named-entity id="named-entity-465">FOXO3a</named-entity>, as indicated. After crosslink reversal, the co-immunoprecipitated DNA was amplified by rtPCR. Shown are the means of duplicates within one experiment. IP, immunoprecipitate; TSS, transcription start site. (<b>d</b>) DLD1 cells expressing <named-entity id="named-entity-466">FOXO3</named-entity>(A3)-ER were stimulated with <named-entity id="named-entity-467">4-OHT</named-entity>. Cell lysates were analysed for protein levels of <named-entity id="named-entity-468">glutamine synthetase</named-entity>, <named-entity id="named-entity-469">p27</named-entity> and actin. Shown are representative blots (<i>n</i>=4). (<b>e</b>) The osteosarcoma cell line U2OS expressing FOXO(A3)-ER was stimulated with <named-entity id="named-entity-470">4-OHT</named-entity>, cells were lysed and equal amounts of proteins were analysed for levels of <named-entity id="named-entity-471">glutamine synthetase</named-entity> and actin. (<b>f</b>) MSCs expressing FOXO(A3)-ER were stimulated with <named-entity id="named-entity-472">4-OHT</named-entity>, cells were lysed and equal amounts of proteins were analysed for levels of <named-entity id="named-entity-473">glutamine synthetase</named-entity> and actin. Shown are representative blots (<i>n</i>=3). (<b>g</b>) Wild-type, <i><named-entity id="named-entity-474">daf-2</named-entity></i> and <i><named-entity id="named-entity-475">daf-16</named-entity></i> mutant worms were synchronized to L1 by <named-entity id="named-entity-476">hypochlorite</named-entity> treatment and were placed on nematode growth medium agar plates. After five days worms were lysed in <named-entity id="named-entity-477">imidazole</named-entity> and analysed for <named-entity id="named-entity-478">glutamine synthetase</named-entity> activity. (<b>h</b>) Wild-type N2 worms or <i><named-entity id="named-entity-479">daf-2</named-entity></i> mutants were synchronized to L1 by <named-entity id="named-entity-480">hypochlorite</named-entity> treatment and placed on nematode growth medium plates with or without bacteria expressing <named-entity id="named-entity-481">DAF-16</named-entity> double-stranded RNA. After five days worms were lysed in <named-entity id="named-entity-482">imidazole</named-entity> and analysed for <named-entity id="named-entity-483">glutamine synthetase</named-entity> activity. (<b>g</b>,<b>h</b>) Shown are the means of five independent plates for each condition. Uncropped images of blots are shown in <sir rid="s1" refobjid="ncb2536-s1">Supplementary Fig. S7</sir>.</p>
|
https://api.sourcedata.io/file.php?figure_id=3043
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P46414",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "p27",
"type": "geneprod",
"uniprot_ids": [
"P46414"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15105",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "56484",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "56484",
"original_type": "gene",
"role": "intervention",
"text": "FOXO3",
"type": "geneprod",
"uniprot_ids": [
"Q9WVH4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15105",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9GZQ8///Q9BXW4///Q9H492",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P46527",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "p27",
"type": "geneprod",
"uniprot_ids": [
"P46527"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15104",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15104"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15104",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15104"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15104",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15104"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "172981",
"ext_tax_ids": "6239",
"ext_tax_names": "Caenorhabditis elegans",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "172981",
"original_type": "gene",
"role": "intervention",
"text": "daf-16",
"type": "geneprod",
"uniprot_ids": [
"O16850",
"A0A0K3AR63",
"A0A0K3AR95",
"A0A0K3ATP5",
"A0A0K3AWG6"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "175410",
"ext_tax_ids": "6239",
"ext_tax_names": "Caenorhabditis elegans",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "175410",
"original_type": "gene",
"role": "intervention",
"text": "daf-2",
"type": "geneprod",
"uniprot_ids": [
"Q968Y9",
"A0A0K3ARE8",
"A0A0K3ARZ1",
"A0A0K3AUA1",
"A0A0K3AXA0"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P34497",
"ext_tax_ids": "6239",
"ext_tax_names": "Caenorhabditis elegans",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P34497"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "172981",
"ext_tax_ids": "6239",
"ext_tax_names": "Caenorhabditis elegans",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "172981",
"original_type": "gene",
"role": "intervention",
"text": "DAF-16",
"type": "geneprod",
"uniprot_ids": [
"O16850",
"A0A0K3AR63",
"A0A0K3AR95",
"A0A0K3ATP5",
"A0A0K3AWG6"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "175410",
"ext_tax_ids": "6239",
"ext_tax_names": "Caenorhabditis elegans",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "175410",
"original_type": "gene",
"role": "intervention",
"text": "daf-2",
"type": "geneprod",
"uniprot_ids": [
"Q968Y9",
"A0A0K3ARE8",
"A0A0K3ARZ1",
"A0A0K3AUA1",
"A0A0K3AXA0"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P34497",
"ext_tax_ids": "6239",
"ext_tax_names": "Caenorhabditis elegans",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P34497"
]
}
] |
|
22820375
|
10.1038/ncb2536
|
Modulation of glutamine metabolism by the PI(3)K–PKB–FOXO network regulates autophagy
|
2012
|
figf3
|
<p>(<b>a</b>) Ba/F3 cells expressing <named-entity id="named-entity-485">FOXO3</named-entity>(A3)-ER were stimulated with <named-entity id="named-entity-486">4-OHT</named-entity> in the presence of <named-entity id="named-entity-487">mIL-3</named-entity>. Cell lysates were analysed for <named-entity id="named-entity-488">glutamine synthetase</named-entity> (<named-entity id="named-entity-489">GS</named-entity>) activity in an enzyme assay (left). In addition, the expression of <named-entity id="named-entity-490">glutamine synthetase</named-entity>, <named-entity id="named-entity-491">p27</named-entity> and actin was determined using western blot (right). Shown are the mean ± s.e.m. (<i>n</i>=3) and representative blots of these experiments.
<super>**</super><i>P</i>0.01. (<b>b</b>) Ba/F3 cells expressing <named-entity id="named-entity-492">FOXO3</named-entity>(A3)-ER were stimulated with <named-entity id="named-entity-493">4-OHT</named-entity> for 16 h in the presence of <named-entity id="named-entity-494">mIL-3</named-entity> together with <named-entity id="named-entity-495">MSO</named-entity>, as indicated. Cell lysates were analysed for <named-entity id="named-entity-496">glutamine synthetase</named-entity> activity in an enzyme assay (left). Furthermore the expression levels of <named-entity id="named-entity-497">glutamine synthetase</named-entity>, <named-entity id="named-entity-498">p27</named-entity> and actin were determined using western blot (right). Shown are the mean ± s.e.m. (<i>n</i>=3) and representative blots of these experiments.
<super>*</super><i>P</i>0.05,
<super>**</super><i>P</i>0.01. (<b>c</b>) Ba/F3 cells expressing myrPI(3)K-ER were cytokine-starved overnight. The next day, cells were washed in PBS and put in a medium without serum, with or without <named-entity id="named-entity-499">4-OHT</named-entity>. At the times indicated, medium samples were taken and analysed for amino acid levels by high-performance liquid chromatography. Cells were lysed and equal amounts of protein were analysed by western blotting for levels of phospho-PKB (S473), phospho-<named-entity id="named-entity-500">FOXO3</named-entity> (T32) and actin (inset). Shown are the mean of relative amino acid levels, compared with
<i>t</i>=0 (<i>n</i>=2), and representative blots of these experiments. (<b>d</b>) Ba/F3 cells expressing <named-entity id="named-entity-501">FOXO3</named-entity>(A3)-ER were stimulated with <named-entity id="named-entity-502">4-OHT</named-entity> in serum-free medium containing <named-entity id="named-entity-503">mIL-3</named-entity>. The medium was analysed for amino acid levels by high-performance liquid chromatography. Cells were lysed and analysed for protein levels of <named-entity id="named-entity-504">glutamine synthetase</named-entity>, <named-entity id="named-entity-505">p27</named-entity> and actin (inset). Shown are the mean ± s.e.m. of relative amino acid levels, compared with
<i>t</i>=0 (<i>n</i>=4), and representative blots of these experiments.
<super>**</super><i>P</i>0.01. Uncropped images of blots are shown in <sir rid="s1" refobjid="ncb2536-s1">Supplementary Fig. S7</sir>.</p>
|
https://api.sourcedata.io/file.php?figure_id=3044
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P46414",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "p27",
"type": "geneprod",
"uniprot_ids": [
"P46414"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15105",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15105",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P46414",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "p27",
"type": "geneprod",
"uniprot_ids": [
"P46414"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15105",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15105",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9WUA6///P31750///Q60823",
"ext_tax_ids": "10090///10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PKB",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9WVH4",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "FOXO3",
"type": "geneprod",
"uniprot_ids": [
"Q9WVH4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P46414",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "p27",
"type": "geneprod",
"uniprot_ids": [
"P46414"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15105",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
}
] |
|
22820375
|
10.1038/ncb2536
|
Modulation of glutamine metabolism by the PI(3)K–PKB–FOXO network regulates autophagy
|
2012
|
figf4
|
<p>(<b>a</b>) DLD1 cells expressing <named-entity id="named-entity-508">FOXO3</named-entity>(A3)-ER were stimulated with <named-entity id="named-entity-509">4-OHT</named-entity> with or without <named-entity id="named-entity-510">MSO</named-entity>. After 24 h, the cells were starved of serum, amino acids and <named-entity id="named-entity-511">glucose</named-entity> in D-PBS containing the indicated inhibitors and stimulated with amino acids for 10 min. Cell lysates were analysed for protein levels of phospho-S6K (Thr 389) and actin. Shown are representative blots of three independent experiments. (<b>b</b>,<b>c</b>) DLD1 cells expressing <named-entity id="named-entity-512">FOXO3</named-entity>(A3)-ER were stimulated with <named-entity id="named-entity-513">4-OHT</named-entity> and <named-entity id="named-entity-514">MSO</named-entity> (0.25 M) for 24 h in <named-entity id="named-entity-515">glutamine</named-entity>-free DMEM containing 0.1% FCS. Cells were stained for <named-entity id="named-entity-516">mTOR</named-entity> and <named-entity id="named-entity-517">LAMP2</named-entity> and analysed by confocal microscopy. (<b>b</b>) Shown are representative pictures (<i>n</i>=4). Scale bars, 100 μm. (<b>c</b>) Quantification of co-localization between <named-entity id="named-entity-518">mTOR</named-entity> and <named-entity id="named-entity-519">LAMP2</named-entity> as seen in <b>b</b>. Depicted are the mean ± s.e.m. of the percentage of co-localized pixels from four experiments.
<super>*</super><i>P</i>0.05,
<super>**</super><i>P</i>0.01. (<b>d</b>) DLD1 cells expressing <named-entity id="named-entity-520">FOXO3</named-entity>(A3)-ER were treated with or without <named-entity id="named-entity-521">4-OHT</named-entity>, <named-entity id="named-entity-522">MSO</named-entity> and <named-entity id="named-entity-523">BafA1</named-entity> (200 nM). After 24 h, cell lysates were analysed for protein levels of LC3 and tubulin. Shown are representative blots (<i>n</i>=4). (<b>e</b>) DLD1 cells expressing <named-entity id="named-entity-524">FOXO3</named-entity>(A3)-ER were transfected with <named-entity id="named-entity-525">glutamine synthetase</named-entity> (<named-entity id="named-entity-526">GS</named-entity>) siRNA or a non-targeting siRNA and stimulated with <named-entity id="named-entity-527">4-OHT</named-entity> in <named-entity id="named-entity-528">glutamine</named-entity>-free DMEM containing 0.1% FBS. After 24 h, cell lysates were analysed for protein levels of <named-entity id="named-entity-529">glutamine synthetase</named-entity>, LC3 and actin. Shown are representative blots (<i>n</i>=2). (<b>f</b>) DLD1 cells expressing <named-entity id="named-entity-530">FOXO3</named-entity>(A3)-ER were transfected with <named-entity id="named-entity-531">glutamine synthetase</named-entity> siRNA or non-template (NT) control siRNA and stimulated with <named-entity id="named-entity-532">4-OHT</named-entity> for 16 h. Cells were lysed and equal amounts of proteins were analysed for levels of <named-entity id="named-entity-533">p62</named-entity> or <named-entity id="named-entity-534">glutamine synthetase</named-entity>. Shown are representative blots (<i>n</i>=2). (<b>g</b>) DLD1 cells were stimulated with <named-entity id="named-entity-535">LY294002</named-entity> or <named-entity id="named-entity-536">PKB inhibitor VIII</named-entity> for 24 h. Cell lysates were analysed for protein levels of LC3 and actin. Shown are representative blots (<i>n</i>=4). Uncropped images of blots are shown in <sir rid="s1" refobjid="ncb2536-s1">Supplementary Figs S7 and S8</sir>.</p>
|
https://api.sourcedata.io/file.php?figure_id=3045
|
[
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q15418///Q96S38///P23443",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "S6K",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P13473",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LAMP2",
"type": "geneprod",
"uniprot_ids": [
"P13473"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P13473",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LAMP2",
"type": "geneprod",
"uniprot_ids": [
"P13473"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P42345",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "mTOR",
"type": "geneprod",
"uniprot_ids": [
"P42345"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P42345",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "mTOR",
"type": "geneprod",
"uniprot_ids": [
"P42345"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9GZQ8///Q9BXW4///Q9H492",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "2752",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "2752",
"original_type": "gene",
"role": "intervention",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15104",
"A8YXX4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15104",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15104"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9GZQ8///Q9BXW4///Q9H492",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "2752",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "2752",
"original_type": "gene",
"role": "intervention",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15104",
"A8YXX4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15104",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15104"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q13501",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "p62",
"type": "geneprod",
"uniprot_ids": [
"Q13501"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9H492///Q9GZQ8///Q9BXW4",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
}
] |
|
22820375
|
10.1038/ncb2536
|
Modulation of glutamine metabolism by the PI(3)K–PKB–FOXO network regulates autophagy
|
2012
|
figf5
|
<p>(<b>a</b>) DLD1 cells expressing <named-entity id="named-entity-538">FOXO3</named-entity>(A3)-ER were stimulated with <named-entity id="named-entity-539">4-OHT</named-entity> and <named-entity id="named-entity-540">MSO</named-entity> for 24 h in <named-entity id="named-entity-541">glutamine</named-entity>-free DMEM containing 0.1% FCS. Cells were stained for LC3 and ER and analysed by confocal microscopy. Shown are representative pictures (<i>n</i>=3). Scale bars, 20 μm. (<b>b</b>) Quantification of LC3-positive spots as seen in <b>a</b> using ImageJ software. Depicted are mean ± s.e.m. of the number of LC3-positive spots divided by the number of <named-entity id="named-entity-542">DAPI</named-entity>-positive cells (<i>n</i>=4).
<super>*</super><i>P</i>0.05. (<b>c</b>) MSCs expressing <named-entity id="named-entity-543">FOXO3</named-entity>(A3)-ER were treated with or without <named-entity id="named-entity-544">4-OHT</named-entity> and <named-entity id="named-entity-545">BafA1</named-entity> (100 nM). At the indicated time points, cell lysates were analysed for protein levels of <named-entity id="named-entity-546">glutamine synthetase</named-entity> (<named-entity id="named-entity-547">GS</named-entity>), LC3, pS6 (Ser 235/236) and actin. Shown are representative blots (<i>n</i>=2). (<b>d</b>) <named-entity id="named-entity-548">IL-3</named-entity> was withdrawn from Ba/F3 cells in the presence or absence of <named-entity id="named-entity-549">BafA1</named-entity> (100 nM) as indicated. Cell lysates were analysed for protein levels of <named-entity id="named-entity-550">glutamine synthetase</named-entity>, LC3 and hsp90. Shown are representative blots (<i>n</i>=2). (<b>e</b>) DLD1 cells were stimulated with <named-entity id="named-entity-551"><sc>l</sc>-glutamine</named-entity> (<named-entity id="named-entity-552"><sc>l</sc>-Gln</named-entity>) in <named-entity id="named-entity-553">glutamine</named-entity>-free DMEM containing 0.1% FBS. After 24 h, cell lysates were analysed for protein levels of LC3, <named-entity id="named-entity-554">p62</named-entity>, p-S6K (Thr 389) and actin. Shown are representative blots (<i>n</i>=3). (<b>f</b>) DLD1 cells were starved and stimulated with <named-entity id="named-entity-555">glutamine</named-entity> (5 and 10 mM). Cells were stained for <named-entity id="named-entity-556">mTOR</named-entity> and <named-entity id="named-entity-557">LAMP2</named-entity> and analysed by confocal microscopy, and the co-localization between <named-entity id="named-entity-558">mTOR</named-entity> and <named-entity id="named-entity-559">LAMP2</named-entity> was quantified by ImageJ. Depicted are the means of the percentage of co-localized pixels (<i>n</i>=2). (<b>g</b>) DLD1 cells expressing <named-entity id="named-entity-560">FOXO3</named-entity>(A3)-ER were transiently transfected with GFP–<named-entity id="named-entity-561">WIPI-1</named-entity> and subsequently stimulated with <named-entity id="named-entity-562">4-OHT</named-entity> in the presence or absence of <named-entity id="named-entity-563">MSO</named-entity> in <named-entity id="named-entity-564">glutamine</named-entity>-free DMEM containing 0.1% FCS or medium without amino acids for 24 h. GFP–WIPI-1 puncta formation analysis was performed by confocal microscopy. Depicted are the percentages of cells positive for GFP–<named-entity id="named-entity-565">WIPI-1</named-entity> puncta. Shown are the mean ± s.e.m. (<i>n</i>=4).
<super>*</super><i>P</i>0.05 and
<super>**</super><i>P</i>0.01. Uncropped images of blots are shown in <sir rid="s1" refobjid="ncb2536-s1">Supplementary Fig. S8</sir>.</p>
|
https://api.sourcedata.io/file.php?figure_id=3046
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P03372",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ER",
"type": "geneprod",
"uniprot_ids": [
"P03372"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9GZQ8///Q9BXW4///Q9H492",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9GZQ8///Q9BXW4///Q9H492",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9GZQ8///Q9BXW4///Q9H492",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15104",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15104"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9GZQ8///Q9BXW4///Q9H492",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q15418///Q96S38///P23443",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "pS6",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15105",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15105"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P08113///P07901///P11499",
"ext_tax_ids": "10090///10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "hsp90",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P01586",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "IL-3",
"type": "geneprod",
"uniprot_ids": [
"P01586"
]
},
{
"ext_dbs": "Uniprot///Uniprot",
"ext_ids": "Q9CQV6///Q91VR7",
"ext_tax_ids": "10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9GZQ8///Q9BXW4///Q9H492",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "P23443///Q15418///Q96S38",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "S6K",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q13501",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "p62",
"type": "geneprod",
"uniprot_ids": [
"Q13501"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P13473",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LAMP2",
"type": "geneprod",
"uniprot_ids": [
"P13473"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P13473",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LAMP2",
"type": "geneprod",
"uniprot_ids": [
"P13473"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P42345",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "mTOR",
"type": "geneprod",
"uniprot_ids": [
"P42345"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P42345",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "mTOR",
"type": "geneprod",
"uniprot_ids": [
"P42345"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q5MNZ9",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "WIPI-1",
"type": "geneprod",
"uniprot_ids": [
"Q5MNZ9"
]
}
] |
|
22820375
|
10.1038/ncb2536
|
Modulation of glutamine metabolism by the PI(3)K–PKB–FOXO network regulates autophagy
|
2012
|
figf6
|
<p>(<b>a</b>) DLD1 cells expressing <named-entity id="named-entity-567">FOXO3</named-entity>(A3)-ER were transiently transfected with GFP–<named-entity id="named-entity-568">ULK2</named-entity> and stimulated with <named-entity id="named-entity-569">4-OHT</named-entity> and <named-entity id="named-entity-570">MSO</named-entity> for 24 h in <named-entity id="named-entity-571">glutamine</named-entity>-free DMEM containing 0.1% FCS. Cells were stained for LC3 and analysed by confocal microscopy. Shown are representative pictures (<i>n</i>=3). Scale bars, 20 μm. (<b>b</b>) DLD1 cells expressing <named-entity id="named-entity-572">FOXO3</named-entity>(A3)-ER were transiently transfected with GFP–<named-entity id="named-entity-573">WIPI-1</named-entity> and subsequently treated with <named-entity id="named-entity-574">4-OHT</named-entity> in the presence or absence of <named-entity id="named-entity-575">MSO</named-entity> in <named-entity id="named-entity-576">glutamine</named-entity>-free DMEM containing 0.1% FCS. After 24 h, cells were analysed for GFP and <named-entity id="named-entity-577">p62</named-entity> expression by confocal microscopy. Shown are representative pictures (<i>n</i>=3). Scale bar, 20 μm. (<b>c</b>) DLD1 cells expressing <named-entity id="named-entity-578">FOXO3</named-entity>(A3)-ER were treated with <named-entity id="named-entity-579">4-OHT</named-entity> and <named-entity id="named-entity-580">MSO</named-entity> in <named-entity id="named-entity-581">glutamine</named-entity>-free DMEM containing 0.1% FCS. After 24 h cells were analysed for endogenous <named-entity id="named-entity-582">Atg12</named-entity> puncta formation by confocal microscopy. Shown are the mean ± s.d. (<i>n</i>=3).
<super>*</super><i>P</i>0.05. (<b>d</b>) DLD1 cells expressing FOXO(A3)-ER were transfected with <named-entity id="named-entity-583">glutamine synthetase</named-entity> (<named-entity id="named-entity-584">GS</named-entity>) siRNA or non-template (NT) control siRNA, and stimulated with <named-entity id="named-entity-585">4-OHT</named-entity> for 24 h with or without <named-entity id="named-entity-586">3-methyladenine</named-entity> (<named-entity id="named-entity-587">3-MA</named-entity>). Apoptosis was determined by FACS analysis after labelling cells with annexin V (AxV)–phycoerythrin and <named-entity id="named-entity-588">DAPI</named-entity>. The graph shows relative fold versus control samples, mean ± s.e.m. (<i>n</i>=3).
<super>*</super><i>P</i>0.05.</p>
|
https://api.sourcedata.io/file.php?figure_id=3047
|
[
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9GZQ8///Q9BXW4///Q9H492",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q13501",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "p62",
"type": "geneprod",
"uniprot_ids": [
"Q13501"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O94817",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Atg12",
"type": "geneprod",
"uniprot_ids": [
"O94817"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "2752",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "2752",
"original_type": "gene",
"role": "intervention",
"text": "glutamine synthetase",
"type": "geneprod",
"uniprot_ids": [
"P15104",
"A8YXX4"
]
}
] |
|
10.15252/embr.202153955
|
Cardio-respiratory and phenotypicrescue of dystrophin/utrophin-deficientmice by combination therapy
|
2022
|
Figure 1
|
<sd-panel><p><strong>Figure 1. Effects of dietary supplementation of glycine on the activity of PMO in adult <em>mdx</em> mice.</strong></p> <p><strong>PMO was administered intravenously into adult <em>mdx</em> mice at 25 or 50 mg/kg/week for 3 weeks with dietary supplementation of glycine for 3</strong> consecutive <strong>days per week prior to PMO administration.</strong></p> <p><strong>(A) Diagram of dosing regimen for PMO supplemented with glycine orally in <em>mdx</em> mice. I.v. refers to intravenous injection.</strong></p> <p><strong>(B) Immunohistochemistry for dystrophin expression in body-wide muscles from <em>mdx</em> mice treated with PMO in saline (PMO-S), PMO-G(IV) or PMO-G (D)(scale bar=100μm).PMO-G (IV) refers to intravenous injection of PMO in combination with intravenous injection of 5% glycine every other day for 3 weeks. PMO-G (D) represents intravenous injection of PMO supplemented with 1% glycine orally.</strong></p> <p><strong>(C) Western blot for dystrophin expression in body-wide muscles from <em>mdx</em> mice treated with PMO-G (IV), PMO-G (D) or PMO-S. 0.5µg, 2.5 µg, 5µg, 10µg and 15µg total protein from <em>C57BL/6</em> and 50 µg of muscle samples from untreated and treated <em>mdx</em> mice were loaded. α-actinin was used as the loading control. TA-tibialis anterior, Q-quadriceps, G-gastrocnemius, T-triceps, D-diaphragm and A-abdominal muscle.</strong></p> <p><strong>(D) Quantitative analysis of dystrophin expression in body-wide muscles from <em>mdx</em> mice treated with PMO-G (i.v., n=4), PMO-G (D25 and D50, n=3) and PMO-S (n=3) (*P<0.05,**P<0.001; One way-ANOVA post hoc Student-Newman-Keuls test).</strong></p> <p><strong>Data information: Error bars indicate s.e.m. Data shown are representative of biological replicates as specified.</strong></p></sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=46840
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "13405",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "13405",
"original_type": "gene",
"role": "intervention",
"text": "mdx",
"type": "geneprod",
"uniprot_ids": [
"P11531",
"A0A023ZT56",
"A0A023ZTV5",
"A2A9Z1",
"A2A9Z2",
"Q3TWL4",
"Q8BHM1"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "13405",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "13405",
"original_type": "gene",
"role": "intervention",
"text": "mdx",
"type": "geneprod",
"uniprot_ids": [
"P11531",
"A0A023ZT56",
"A0A023ZTV5",
"A2A9Z1",
"A2A9Z2",
"Q3TWL4",
"Q8BHM1"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P11531",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "dystrophin",
"type": "geneprod",
"uniprot_ids": [
"P11531"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "13405",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "13405",
"original_type": "gene",
"role": "intervention",
"text": "mdx",
"type": "geneprod",
"uniprot_ids": [
"P11531",
"A0A023ZT56",
"A0A023ZTV5",
"A2A9Z1",
"A2A9Z2",
"Q3TWL4",
"Q8BHM1"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "13405",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "13405",
"original_type": "gene",
"role": "intervention",
"text": "mdx",
"type": "geneprod",
"uniprot_ids": [
"P11531",
"A0A023ZT56",
"A0A023ZTV5",
"A2A9Z1",
"A2A9Z2",
"Q3TWL4",
"Q8BHM1"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "13405",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "13405",
"original_type": "gene",
"role": "intervention",
"text": "mdx",
"type": "geneprod",
"uniprot_ids": [
"P11531",
"A0A023ZT56",
"A0A023ZTV5",
"A2A9Z1",
"A2A9Z2",
"Q3TWL4",
"Q8BHM1"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "13405",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "13405",
"original_type": "gene",
"role": "intervention",
"text": "mdx",
"type": "geneprod",
"uniprot_ids": [
"P11531",
"A0A023ZT56",
"A0A023ZTV5",
"A2A9Z1",
"A2A9Z2",
"Q3TWL4",
"Q8BHM1"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P11531",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "dystrophin",
"type": "geneprod",
"uniprot_ids": [
"P11531"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P11531",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "dystrophin",
"type": "geneprod",
"uniprot_ids": [
"P11531"
]
}
] |
||
10.15252/embr.202153955
|
Cardio-respiratory and phenotypicrescue of dystrophin/utrophin-deficientmice by combination therapy
|
2022
|
Figure 2
|
<sd-panel>Figure 2. Evaluation of <sd-pretag id="sdPretag899328710sm" type="small" role="intervention">PMO</sd-pretag> supplemented with <sd-pretag id="sdPretag124802250sm" type="small" role="intervention">glycine</sd-pretag> orally in DKO <sd-pretag id="sdPretag124241746sm" type="organism" role="component">mice</sd-pretag>. PMO was administered intravenously into 3-week old DKO <sd-pretag id="sdPretag958445093sm" type="organism" role="component">mice</sd-pretag> at 50 mg/kg/week for 3 weeks with dietary supplementation of <sd-pretag id="sdPretag134515730sm" type="small" role="intervention">1% glycine</sd-pretag> for 3 consecutive days per week prior to <sd-pretag id="sdPretag373053600sm" type="small" role="assayed">PMO</sd-pretag> introduction (PMO-G). (A) <sd-pretag id="sdPretag38195248sm" type="tissue" role="component">Muscle</sd-pretag> function was assessed to determine the physical improvement with grip strength test (n=3, *P<0.05; One way-ANOVA post hoc Student-Newman-Keuls test). (B) Measurement of bodyweight changes of DKO <sd-pretag id="sdPretag288013426sm" type="organism" role="component">mice</sd-pretag> treated with <sd-pretag id="sdPretag1012269994sm" type="small" role="intervention">PMO-G</sd-pretag> or <sd-pretag id="sdPretag1988560691sm" type="small" role="intervention">PMO</sd-pretag>-S (n=3; *P<0.05; One way-ANOVA post hoc Student-Newman-Keuls test). (C) Measurement of <sd-pretag id="sdPretag29375602sm" type="tissue" role="component">TA muscle</sd-pretag> mass of DKO <sd-pretag id="sdPretag930305193sm" type="organism" role="component">mice</sd-pretag> treated with <sd-pretag id="sdPretag1906643839sm" type="small" role="intervention">PMO-G</sd-pretag> or <sd-pretag id="sdPretag746544213sm" type="small" role="intervention">PMO</sd-pretag>-S (n = 3, *P < 0.05; one-way ANOVA post-hoc Student-Newman-Keuls test). (D) <sd-pretag id="sdPretag42770614sm" category="assay">Immunohistochemistry</sd-pretag> for <sd-pretag id="sdPretag2003043303sm" type="geneprod" role="assayed">dystrophin</sd-pretag> expression in treated DKO <sd-pretag id="sdPretag281771639sm" type="organism" role="component">mice</sd-pretag> (scale bar=100 μm). (E, F) <sd-pretag id="sdPretag1060988606sm" category="assay">Western blot</sd-pretag> (D) and quantitative analysis (E) for the <sd-pretag id="sdPretag1279096821sm" type="geneprod" role="assayed">dystrophin</sd-pretag> protein in treated DKO <sd-pretag id="sdPretag482698084sm" type="organism" role="component">mice</sd-pretag> (n=3, *P<0.05; One way-ANOVA post hoc Student-Newman -Keuls test). <sd-pretag id="sdPretag1764151223sm" type="tissue" role="component">TA-tibialis anterior</sd-pretag>, <sd-pretag id="sdPretag1641514394sm" type="tissue" role="component">Q-quadriceps</sd-pretag>, <sd-pretag id="sdPretag1266983768sm" type="tissue" role="component">G-gastrocnemius</sd-pretag>, <sd-pretag id="sdPretag991398705sm" type="tissue" role="component">T-triceps</sd-pretag>, <sd-pretag id="sdPretag1365098066sm" type="tissue" role="component">A-abdominal muscle</sd-pretag> and <sd-pretag id="sdPretag1574914721sm" type="tissue" role="component">D-diaphragm</sd-pretag>. 2.5 µg, 5µg and 15µg total protein from <sd-pretag id="sdPretag1464669707sm" type="organism" role="component">C57BL/6</sd-pretag> and 50 µg of <sd-pretag id="sdPretag302897682sm" type="tissue" role="component">muscle</sd-pretag> samples from untreated and treated <sd-pretag id="sdPretag1129392539sm" category="disease">DKO</sd-pretag> <sd-pretag id="sdPretag1028015963sm" category="disease">mice</sd-pretag> were loaded. <sd-pretag id="sdPretag447580748sm" type="geneprod" role="assayed">α-actinin</sd-pretag> was used as the loading control. Data information: Error bars indicate s.e.m. Data shown are representative of biological replicates as specified.</sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=46842
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P11531",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "dystrophin",
"type": "geneprod",
"uniprot_ids": [
"P11531"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P11531",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "dystrophin",
"type": "geneprod",
"uniprot_ids": [
"P11531"
]
}
] |
||
10.15252/embr.202153955
|
Cardio-respiratory and phenotypicrescue of dystrophin/utrophin-deficientmice by combination therapy
|
2022
|
Figure 3
|
<sd-panel><p><strong>Figure 3. Systemic investigation of combinatorial effects of <sd-pretag id="sdPretag277530359sm" type="small" role="intervention">PMO</sd-pretag> with dietary supplementation of <sd-pretag id="sdPretag736676644sm" type="small" role="intervention">glycine</sd-pretag> and <sd-pretag id="sdPretag1843657714sm" type="small" role="intervention">metformin</sd-pretag> in <em>DKO</em> <sd-pretag id="sdPretag1391610268sm" type="organism" role="component">mice</sd-pretag>.</strong></p> <p><strong>PMO was administered intravenously into 3-week old <em>DKO</em> <sd-pretag id="sdPretag722255558sm" type="organism" role="component">mice</sd-pretag> at 50 mg/kg/week for 3 weeks with dietary supplementation of <sd-pretag id="sdPretag1137132945sm" type="small" role="intervention">glycine</sd-pretag> for 3 consecutive days per week prior to PMO introduction (PMO-G) and metformin daily via drinking water (PMO-GM).</strong></p> <p><strong>(A) Diagram of dosing regimen for PMO supplemented with <sd-pretag id="sdPretag258975490sm" type="small" role="intervention">glycine</sd-pretag> and <sd-pretag id="sdPretag275935574sm" type="small" role="intervention">metformin</sd-pretag> orally in <em>DKO</em> <sd-pretag id="sdPretag308266904sm" type="organism" role="component">mice</sd-pretag>. I.v. refers to intravenous injection.</strong></p> <p><strong>(B) Measurement of Ejection Fraction (EF) and Fractional Shortening (FS) in treated <em>DKO</em> <sd-pretag id="sdPretag417018404sm" type="organism" role="component">mouse</sd-pretag> <sd-pretag id="sdPretag421817854sm" type="tissue" role="component">hearts</sd-pretag> (n=3) and <sd-pretag id="sdPretag547779933sm" type="organism" role="component"><em>C57BL/6</em> mice</sd-pretag> (n=6) with <sd-pretag id="sdPretag1913606961sm" category="assay">echocardiography</sd-pretag> (*P<0.05; one-way ANOVA post hoc Student-Newman-Keuls test).</strong></p> <p><strong>(C) Morphological examination of treated <em>DKO</em> <sd-pretag id="sdPretag1572612567sm" type="organism" role="component">mouse</sd-pretag> <sd-pretag id="sdPretag1424117945sm" type="tissue" role="component">hearts</sd-pretag> with H&E <sd-pretag id="sdPretag1996505948sm" category="assay">staining</sd-pretag> (scale bar=800μm). Boxed areas are magnified. (n=3, *P<0.05; one-way ANOVA post hoc Student-Newman-Keuls test)</strong></p> <p><strong>(D-F) <sd-pretag id="sdPretag597917014sm" category="assay">Immunohistochemistry</sd-pretag> for immunoglobin G (IgG) in treated <em>DKO</em> <sd-pretag id="sdPretag981393005sm" type="organism" role="component">mouse</sd-pretag> <sd-pretag id="sdPretag2141799934sm" type="tissue" role="component">hearts</sd-pretag> (D, scale bar=100 μm). <sd-pretag id="sdPretag1379463645sm" type="tissue" role="component">Muscle</sd-pretag> function was evaluated to determine the physical improvement with grip strength (E) or <sd-pretag id="sdPretag156680868sm" category="assay">running wheel</sd-pretag> tests (F) for treated <em>DKO</em> (n=3) or <sd-pretag id="sdPretag1581518200sm" type="organism" role="component"><em>C57BL/6</em> mice</sd-pretag> (n=4) (*P<0.05; One way-ANOVA post hoc Student-Newman -Keuls test).</strong></p> <p><strong>(G) <sd-pretag id="sdPretag1900990500sm" category="assay">Immunohistochemistry</sd-pretag> for <sd-pretag id="sdPretag646014653sm" type="geneprod" role="assayed">dystrophin</sd-pretag> expression in body-wide <sd-pretag id="sdPretag441516593sm" type="tissue" role="component">muscles</sd-pretag> from treated <em>DKO</em> <sd-pretag id="sdPretag1922074203sm" type="organism" role="component">mice</sd-pretag> (scale bar=100 μm).</strong></p> <p><strong>(H) <sd-pretag id="sdPretag1971187391sm" category="assay">Western blot</sd-pretag> and quantitative analysis for <sd-pretag id="sdPretag70089857sm" type="geneprod" role="assayed">dystrophin</sd-pretag> protein in treated <em>DKO</em> <sd-pretag id="sdPretag1109200681sm" type="organism" role="component">mice</sd-pretag> (n=3). 5µg, 10µg and 20µg total protein from <sd-pretag id="sdPretag107315754sm" type="organism" role="component"><em>C57BL/6</em></sd-pretag> and 50 µg of <sd-pretag id="sdPretag1369921872sm" type="tissue" role="component">muscle</sd-pretag> samples from untreated and treated <em>DKO</em> <sd-pretag id="sdPretag20989020sm" type="organism" role="component">mice</sd-pretag> were loaded. <sd-pretag id="sdPretag1317437341sm" type="geneprod" role="assayed">α-actinin</sd-pretag> was used as the loading control.</strong></p> <p><strong>Data information: Error bars indicate s.e.m. Data shown are representative of biological replicates as specified.</strong></p></sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=46844
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P11531",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "dystrophin",
"type": "geneprod",
"uniprot_ids": [
"P11531"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P11531",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "dystrophin",
"type": "geneprod",
"uniprot_ids": [
"P11531"
]
}
] |
||
10.15252/embr.202153955
|
Cardio-respiratory and phenotypicrescue of dystrophin/utrophin-deficientmice by combination therapy
|
2022
|
Figure 4
|
<sd-panel><p><strong>Figure 4. Long-term combinatorial effects of PMO with dietary supplementation of glycine and metformin (PMO-GM) in <em>DKO</em> mice.</strong></p> <p><strong>PMO was administered intravenously into 3-week old <em>DKO</em> mice at 50 mg/kg/week for 3 weeks with dietary supplementation of glycine for 3 consecutive days per week prior to PMO introduction, followed by 50 mg/kg/month for 5 months with dietary supplementation of glycine for 7</strong> consecutive <strong>days per month prior to PMO introduction, in combination with metformin daily via drinking water.</strong></p> <p><strong>(A) Diagram of long-term dosing regimen for PMO supplemented with glycine and metformin orally in <em>DKO</em> mice. I.v. refers to intravenous injection.</strong></p> <p><strong>(B) Survival rate of <em>DKO</em> mice treated with PMO-GM (n=6).The number of untreated <em>DKO</em> controls is 15.</strong></p> <p><strong>(C) Measurement of kyphosis index of <em>DKO</em> mice treated with PMO-GM (scale bar=5mm) and wild-type <em>C57BL/6</em> mice (scale bar=8mm)(n=3, *P<0.05; One way- ANOVA post hoc Student-Newman-Keuls test).</strong></p> <p><strong>(D) Measurement of tidal volume in treated <em>DKO</em> mice with a cardio-respiratory gated technique (n=3, *P<0.05; one-way ANOVA post hoc Student-Newman-Keuls test). (E-F) Examination of EF and FS (E) and stroke volume and cardiac output (F) in treated <em>DKO</em> mouse hearts (n=3) and <em>C57BL/6</em>(n=5) with echocardiography (*P<0.05, **P<0.001; one-way ANOVA post hoc Student-Newman-Keuls test).</strong></p> <p><strong>(G) Masson trichrome's staining for cardiac fibrosis and quantitative analysis of fibrotic areas in treated <em>DKO</em> mouse hearts (scale bar=800 μm). Boxed areas are magnified (n=3, **P<0.001;One way-ANOVA post hoc Student-Newman-Keuls test).</strong></p> <p><strong>(H) Measurement of serum creatine kinase-MB (CK-MB) levels in treated <em>DKO</em> mice (n=3, *P<0.05; One way-ANOVA post hoc Student-Newman-Keuls test).</strong></p> <p><strong>(I-J) Muscle function was assessed to determine the physical improvement with grip strength (I) or running wheel tests (J) in treated <em>DKO</em> (n=4) and <em>C57BL/6</em> mice (n=6) (*P<0.05; One way-ANOVA post hoc Student-Newman-Keuls test).</strong></p> <p><strong>Data information: Error bars indicate s.e.m. Data shown are representative of biological replicates as specified.</strong></p></sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=46846
|
[
{
"ext_dbs": "Uniprot///Uniprot",
"ext_ids": "Q04447///P07310",
"ext_tax_ids": "10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "CK-MB",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot",
"ext_ids": "P07310///Q04447",
"ext_tax_ids": "10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "creatine kinase-MB",
"type": "geneprod",
"uniprot_ids": []
}
] |
||
10.15252/embr.202153955
|
Cardio-respiratory and phenotypicrescue of dystrophin/utrophin-deficientmice by combination therapy
|
2022
|
Figure 5
|
<sd-panel><p><strong>Figure 5. Molecular correction and pathological assessment of <em>DKO</em> <sd-pretag id="sdPretag1345863681sm" type="organism" role="component">mice</sd-pretag> treated with long-term repeated administration of <sd-pretag id="sdPretag510447379sm" type="small" role="intervention">PMO</sd-pretag>-<sd-pretag id="sdPretag1396073377sm" category="assay">GM</sd-pretag>.</strong></p> <p><strong><sd-pretag id="sdPretag1004224002sm" type="cell" role="component">PMO</sd-pretag> was administered intravenously into 3-week old <em>DKO</em> <sd-pretag id="sdPretag1008790364sm" type="organism" role="component">mice</sd-pretag> at 50 mg/kg/week for 3 weeks with dietary supplementation of <sd-pretag id="sdPretag395381879sm" type="small" role="intervention">glycine</sd-pretag> for 3</strong> consecutive <strong>days per week prior to <sd-pretag id="sdPretag1196961322sm" type="small" role="assayed">PMO</sd-pretag> introduction, followed by 50 mg/kg/month for 5 months with dietary supplementation of <sd-pretag id="sdPretag1077206045sm" type="small" role="intervention">glycine</sd-pretag> for 7</strong> consecutive <strong>days per month prior to <sd-pretag id="sdPretag1359558879sm" type="small" role="assayed">PMO</sd-pretag> introduction, in combination with metformin daily via drinking water.</strong></p> <p><strong>(A) <sd-pretag id="sdPretag1867734779sm" category="assay">Immunohistochemistry</sd-pretag> for <sd-pretag id="sdPretag67817542sm" type="geneprod" role="assayed">dystrophin</sd-pretag> expression in treated <em>DKO</em> <sd-pretag id="sdPretag1311108861sm" type="organism" role="component">mice</sd-pretag> (scale bar=100 μm).</strong></p> <p><strong>(B) <sd-pretag id="sdPretag1859797632sm" category="assay">Western blot</sd-pretag> and quantitative analysis for <sd-pretag id="sdPretag1568070959sm" type="geneprod" role="assayed">dystrophin</sd-pretag> protein in treated <em>DKO</em> <sd-pretag id="sdPretag862168924sm" type="organism" role="component">mice</sd-pretag> (n=3).5µg, 10µg and 25µg total protein from <sd-pretag id="sdPretag1880886734sm" type="organism" role="component"><em>C57BL/6</em></sd-pretag> and 50 µg of <sd-pretag id="sdPretag945930997sm" type="tissue" role="component">muscle</sd-pretag> samples from untreated and treated <em>DKO</em> <sd-pretag id="sdPretag900535804sm" type="organism" role="component">mice</sd-pretag> were loaded. <sd-pretag id="sdPretag2009455228sm" type="geneprod" role="assayed">α-actinin</sd-pretag> was used as the loading control.</strong></p> <p><strong>(C) Re-localization of DAPC components in treated <em>DKO</em> <sd-pretag id="sdPretag540957140sm" type="organism" role="component">mice</sd-pretag> to assess <sd-pretag id="sdPretag1445264220sm" type="geneprod" role="intervention">dystrophin</sd-pretag> function and recovery of normal <sd-pretag id="sdPretag117291279sm" type="tissue" role="component">myoarchitecture</sd-pretag> (scale bar=50μm). The arrowheads point to identical <sd-pretag id="sdPretag103464334sm" type="subcellular" role="component">myofibers</sd-pretag>.</strong></p> <p><strong>(D) Measurement of <sd-pretag id="sdPretag1558315632sm" type="tissue" role="component">serum CK</sd-pretag> levels in treated <em>DKO</em> <sd-pretag id="sdPretag1348843081sm" type="organism" role="component">mice</sd-pretag> (n=3, *P<0.05; One way-ANOVA post hoc Student-Newman-Keuls test).</strong></p> <p><strong>(E-F) Measurement of serum indices from treated <em>DKO</em> <sd-pretag id="sdPretag2102069817sm" type="organism" role="component">mice</sd-pretag> to reflect <sd-pretag id="sdPretag1100711290sm" type="tissue" role="component">liver</sd-pretag> (E) and <sd-pretag id="sdPretag1483667890sm" type="tissue" role="component">kidney</sd-pretag> (F) functions (n=3; *P<0.05; One way-ANOVA post hoc Student-Newman- Keuls test).</strong></p> <p><strong>(G) Morphological examination of <sd-pretag id="sdPretag531200743sm" type="tissue" role="component">liver</sd-pretag> and <sd-pretag id="sdPretag394733936sm" type="tissue" role="component">kidney</sd-pretag> from treated <em>DKO</em> <sd-pretag id="sdPretag415467961sm" type="organism" role="component">mice</sd-pretag> (scale bar=50 μm).</strong></p> <p><strong>Data information: Error bars indicate s.e.m. Data shown are representative of biological replicates as specified. Source data are available online for this figure.</strong></p> <p><strong>Expanded View Figure Legends</strong></p></sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=46848
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P11531",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "dystrophin",
"type": "geneprod",
"uniprot_ids": [
"P11531"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P11531",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "dystrophin",
"type": "geneprod",
"uniprot_ids": [
"P11531"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P11531",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "dystrophin",
"type": "geneprod",
"uniprot_ids": [
"P11531"
]
},
{
"ext_dbs": "Uniprot///Uniprot",
"ext_ids": "P07310///Q04447",
"ext_tax_ids": "10090///10090",
"ext_tax_names": "Mus musculus///Mus musculus",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "CK",
"type": "geneprod",
"uniprot_ids": []
}
] |
||
10.15252/embj.2019102930
|
RhoJ integrates attractive and repulsive cues in directional migration of endothelial cells
|
2020
|
Figure 2
|
<sd-panel> <p><strong>Figure 2. GTP- and GDP-RhoJ differentially associate with PlexinD1 and VEGFR2.</strong></p> <ol type="A"> <li> <p>Confocal (left three columns) and super-resolution (right-most columns) images of subcellular distributions of ectopic RhoJ (red), endogenous VEGFR2 (green) and PlexinD1 (left, white; right, blue) in cultured HUVECs 6 h after transfection with the indicated RhoJ constructs. Note the colocalization of WT-RhoJ and CA-RhoJ (Q79L) with PlexinD1 in perinuclear endosomes and DN-RhoJ (T35N) with VEGFR2 in cytoplasmic and nuclear puncta. Light-blue asterisks in the PlexinD1 panels indicate nuclei. See also Appendix Fig S2 for the full images of super-resolution microscopy. Scale bar, 5 µm <strong>(left);</strong> 1 µm (right).</p> </li> <li> <p>Proportion of ectopic RhoJ that colocalized with endogenous VEGFR2 and/or PlexinD1. <em>n</em> = 10 cells per group. Data represent mean.</p> </li> <li> <p>Co-immunoprecipitation (co-IP) from 293T cells 48 h after transfection. WT- and CA-RhoJ associated with PlexinD1, while DN-RhoJ associated with VEGFR2.</p> </li> </ol> <p>Source data are available online for this figure.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=32325
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P35968",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VEGFR2",
"type": "geneprod",
"uniprot_ids": [
"P35968"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P35968",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VEGFR2",
"type": "geneprod",
"uniprot_ids": [
"P35968"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H4E5",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RhoJ",
"type": "geneprod",
"uniprot_ids": [
"Q9H4E5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H4E5",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RhoJ",
"type": "geneprod",
"uniprot_ids": [
"Q9H4E5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H4E5",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RhoJ",
"type": "geneprod",
"uniprot_ids": [
"Q9H4E5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H4E5",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RhoJ",
"type": "geneprod",
"uniprot_ids": [
"Q9H4E5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P35968",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VEGFR2",
"type": "geneprod",
"uniprot_ids": [
"P35968"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H4E5",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RhoJ",
"type": "geneprod",
"uniprot_ids": [
"Q9H4E5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P35968",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VEGFR2",
"type": "geneprod",
"uniprot_ids": [
"P35968"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H4E5",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RhoJ",
"type": "geneprod",
"uniprot_ids": [
"Q9H4E5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H4E5",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RhoJ",
"type": "geneprod",
"uniprot_ids": [
"Q9H4E5"
]
}
] |
||
10.15252/embj.2019102930
|
RhoJ integrates attractive and repulsive cues in directional migration of endothelial cells
|
2020
|
Figure 3
|
<sd-panel> <p><strong>Figure 3. Sema3E induces EC contraction by releasing RhoJ from PlexinD1.</strong></p> <ol type="A"> <li> <p>Schematic representation of full-length PlexinD1 (PD1) and its deletion mutants.</p> </li> <li> <p>Co-IP from 293T cells 48 h after transfection. RhoJ-PlexinD1 binding was disrupted by deleting the RBD or ECD of PlexinD1 and by 30-min stimulation with Sema3E. Arrows indicate PD1 Full (upper, 250 kDa) and PD1△RBD (lower, 1.7 kDa smaller than PD1 Full).</p> </li> <li> <p>PlexinD1 internalization in HUVECs 30 min after Sema3E stimulation. Scale bar, 10 µm.</p> </li> <li> <p>Super-resolution images of subcellular distributions of ectopic WT-RhoJ (red) and endogenous PlexinD1 (green) in HUVECs 24 h after transfection. RhoJ dissociated from internalized PlexinD1 30 min after Sema3E stimulation. Scale bar, 1 µm.</p> </li> <li> <p>Labeling of siRNA-transfected HUVECs with phalloidin (white) 30 min after Sema3E stimulation. Scale bar, 50 µm.</p> </li> <li> <p>Quantification of areas of individual HUVECs. n > 100 cells per group. Data represent mean ± SEM. ***p < 0.001; NS, not significant, by Tukey-Kramer test.</p> </li> <li> <p>A model of Sema3E-induced cell contraction.</p> </li> </ol> <p>Source data are available online for this figure.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=32327
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "67784",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "67784",
"original_type": "gene",
"role": "intervention",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q3UH93"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3UH93",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PD1",
"type": "geneprod",
"uniprot_ids": [
"Q3UH93"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3UH93",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PD1",
"type": "geneprod",
"uniprot_ids": [
"Q3UH93"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3UH93",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PD1",
"type": "geneprod",
"uniprot_ids": [
"Q3UH93"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3UH93",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q3UH93"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H4E5",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RhoJ",
"type": "geneprod",
"uniprot_ids": [
"Q9H4E5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O15041",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "Sema3E",
"type": "geneprod",
"uniprot_ids": [
"O15041"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O15041",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "Sema3E",
"type": "geneprod",
"uniprot_ids": [
"O15041"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H4E5",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RhoJ",
"type": "geneprod",
"uniprot_ids": [
"Q9H4E5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H4E5",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RhoJ",
"type": "geneprod",
"uniprot_ids": [
"Q9H4E5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O15041",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "Sema3E",
"type": "geneprod",
"uniprot_ids": [
"O15041"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O15041",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "Sema3E",
"type": "geneprod",
"uniprot_ids": [
"O15041"
]
}
] |
||
10.15252/embj.2019102930
|
RhoJ integrates attractive and repulsive cues in directional migration of endothelial cells
|
2020
|
Figure 4
|
<sd-panel> <p><strong>Figure 4. RhoJ facilitates Sema3E-indcued reverse EC migration via activation of VEGFR2 and p38 MAPK.</strong></p> <ol type="A"> <li> <p>Co-IP from HUVECs. Blots for β-actin shown in (A) were used to confirm equal loading in (B), as the same cell lysates were analyzed in both experiments.</p> </li> <li> <p>Immunoblots in HUVECs.</p> </li> <li> <p>Immunoblots in siRNA-transfected HUVECs.</p> </li> <li> <p>Co-IP from siRNA-transfected HUVECs. The graph shows relative levels of PlexinD1-VEGFR2 association, in which the values at 0 min are set to 1. <em>n = 3 per group.</em></p> </li> <li> <p>Super-resolution images of receptor colocalization in siRNA-transfected HUVECs 30 min after Sema3E stimulation. Left panels show immunolabeling of VEGFR2 (green), PlexinD1 (red), and Nrp1 (white), with light-blue asterisks indicating nuclei. Middle panels show magnified views of white boxes in the left panels. Right panels represent fluorescence intensity profiles along 5 μm arbitrary lines in the middle panels. Scale bar, 10 µm. The graph shows the proportion of receptor complexes in PlexinD1-positive vesicles. n = 10 cells per group.</p> </li> <li> <p><strong>Trajectory plots (left) and</strong> rose plots (right) <strong>of HUVECs pre-treated with the p38 MAPK inhibitor SB203580 under Sema3E gradient for 12 h. Red trajectories indicate cells with displacement to the negative <em>y</em>-axis at the end of analyses. <em>P</em> values for the Rayleigh test represent non-random distributions of cell endpoints</strong>. The graphs show <strong>FMI along the <em>y</em>- and <em>x</em>-axes during cell migration.</strong> <em>n</em> = 90 cells per group.</p> </li> <li> <p>A model of Serma3E-induced reverse cell migration.</p> </li> </ol> <p>Data information: Data represent mean ± SEM (D and F) and mean (E). *p < 0.05; ***p < 0.001; NS, not significant, by Tukey-Kramer test (D) and Student's <em>t</em>-test (E and F).</p> <p>Source data are available online for this figure.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=32329
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P35968",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VEGFR2",
"type": "geneprod",
"uniprot_ids": [
"P35968"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P35968",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VEGFR2",
"type": "geneprod",
"uniprot_ids": [
"P35968"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O14786",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Nrp1",
"type": "geneprod",
"uniprot_ids": [
"O14786"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O15041",
"ext_tax_ids": "",
"ext_tax_names": "",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "Sema3E",
"type": "geneprod",
"uniprot_ids": [
"O15041"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot///Uniprot",
"ext_ids": "O15264///Q16539///Q15759///P53778",
"ext_tax_ids": "9606///9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "p38",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O15041",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "Sema3E",
"type": "geneprod",
"uniprot_ids": [
"O15041"
]
}
] |
||
10.15252/embj.2019102930
|
RhoJ integrates attractive and repulsive cues in directional migration of endothelial cells
|
2020
|
Figure 5
|
<sd-panel> <p><strong>Figure 5. RhoJ sustains VEGF signals by preventing degradation of internalized VEGFR2.</strong></p> <ol type="A"> <li> <p>Super-resolution images of receptor colocalization in siRNA-transfected HUVECs 30 min after VEGF stimulation. VEGFR2 (green), PlexinD1 (red), and Nrp1 (white) are shown as in Fig 4E. Scale bar, 10 µm. The graph shows the proportion of receptor complexes in the PlexinD1-positive vesicles. Data of "no stimuli" are the same from Fig 4E. n = 10 cells per group.</p> </li> <li> <p>Co-IP from siRNA-transfected HUVECs. The graph shows relative levels of PlexinD1-VEGFR2 association, in which the values at 0 min are set to 1. <em>n = 3 per group</em>.</p> </li> <li> <p>Immunoblots in siRNA-transfected HUVECs. Blots for β-actin shown in (C) were used to confirm equal loading in (D), as the same cell lysates were analyzed in these experiments. The graph shows changes of total VEGFR2 protein levels as a percentage of the values at 0 min. n <em>=</em> 3 per group.</p> </li> <li> <p>Immunoblots in siRNA-transfected HUVECs. Note the early and transient activation of PLCγ, Erk1/2, and Akt, but not p38 MAPK, in RhoJ-knockdown ECs.</p> </li> <li> <p>Immunoblots for ectopic RhoJ and endogenous VEGFR2 in HUVECs 12 h after transfection of RhoJ-expressing vectors. The graph shows protein levels of VEGFR2 relative to those of the control set as 100%. <em>n = 3 per group.</em></p> </li> <li> <p>A model of VEGF-induced forward cell migration.</p> </li> </ol> <p>Data information: Data represent mean (A) and mean ± SEM (B, C, and E). *p < 0.05; **p < 0.01; ***p < 0.001; NS, not significant, by Student's <em>t</em>-test (A) and Tukey-Kramer test (B, C, and E).</p> <p>Source data are available online for this figure.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=32331
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P35968",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VEGFR2",
"type": "geneprod",
"uniprot_ids": [
"P35968"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O14786",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Nrp1",
"type": "geneprod",
"uniprot_ids": [
"O14786"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P15692",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "VEGF",
"type": "geneprod",
"uniprot_ids": [
"P15692"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P35968",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VEGFR2",
"type": "geneprod",
"uniprot_ids": [
"P35968"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9Y4D7",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PlexinD1",
"type": "geneprod",
"uniprot_ids": [
"Q9Y4D7"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P35968",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VEGFR2",
"type": "geneprod",
"uniprot_ids": [
"P35968"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "57381",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "57381",
"original_type": "gene",
"role": "intervention",
"text": "RhoJ",
"type": "geneprod",
"uniprot_ids": [
"Q9H4E5",
"Q7Z513"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9Y243///P31751///P31749",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Akt",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot///Uniprot",
"ext_ids": "O15264///Q16539///Q15759///P53778",
"ext_tax_ids": "9606///9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "p38",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P27361",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Erk1",
"type": "geneprod",
"uniprot_ids": [
"P27361"
]
},
{
"ext_dbs": "Uniprot///Uniprot",
"ext_ids": "P16885///P19174",
"ext_tax_ids": "9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PLCγ",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P35968",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VEGFR2",
"type": "geneprod",
"uniprot_ids": [
"P35968"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P35968",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "VEGFR2",
"type": "geneprod",
"uniprot_ids": [
"P35968"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H4E5",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RhoJ",
"type": "geneprod",
"uniprot_ids": [
"Q9H4E5"
]
}
] |
||
10.15252/embj.2019102930
|
RhoJ integrates attractive and repulsive cues in directional migration of endothelial cells
|
2020
|
Figure 6
|
<sd-panel> <p><strong>Figure 6. RhoJ promotes directional EC migration in sprouting vessels.</strong></p> <ol type="A"> <li> <p>Kinetic analyses of EC migration in an <em>ex vivo</em> aortic ring angiogenesis model. Upper panels are snapshots of time-lapse imaging in which EC nuclei are labeled by SYTO dye (green). In analyzed regions framed by dotted lines, the centroids of the first five EC nuclei from the tip at 0 min are pseudocolored in magenta and those of the remaining EC nuclei are shown in cyan. Initial discrete labeling becomes intermixed over time (see also Movie EV1). Lower panels show trajectory analyses representing normalized positional changes of individual ECs during vessel elongation. Scale bar, 100 µm.</p> </li> <li> <p>Quantification of the kinetics of EC migration. Values of forward and reverse migration for <em>Rhoj<sup>WT/WT</sup></em> are normalized to 1. <em>n</em> = 33 vessel branches per group.</p> </li> <li> <p>Quantification of vessel elongation (left graph). <em>n</em> = 33 vessel branches per group. Scatter plot shows relationship between "vessel elongation" and "reverse migration" in <em>Rhoj<sup>GFP/GFP</sup></em> aortic rings as evaluated by a Pearson correlation coefficient.</p> </li> <li> <p>Schematic representation for construction of <em>Rhoj</em> mutant mice. Cre-<em>loxP</em>-mediated genetic recombination of the <em>Rhoj</em>-flox allele generates the <em>Rhoj</em>-KO allele by excising the RhoJ cDNA-polyA cassette inserted into exon 1 of the <em>Rhoj</em> gene.</p> </li> <li> <p>Labeling for YFP/GFP (green), CD31 (red), and ETS transcription factor ERG (blue) in retinal vascular fronts of P5 <em>CAG-MerCreMer:R26R-EYFP<sup>flox/WT</sup></em> and <em>CAG-MerCreMer:Rhoj<sup>floxflox</sup></em> mice after intraperitoneal (i.p.) injections of 10 µg of 4-hydroxytamoxifen (4OHT) at P1. Scale bar, 50 µm.</p> </li> <li> <p>Relative contribution of YFP/GFP-positive ECs to the tip positions. <em>n</em> = 16 per group. Values for <em>CAG-MerCreMer:R26R-EYP<sup>flox/WT</sup></em> are normalized to 1.</p> </li> </ol> <p>Data information: Data represent mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001; NS, not significant, by Student's <em>t</em>-test (B and C) and Mann-Whitney <em>U</em>-test (F).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=32333
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P81270",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ERG",
"type": "geneprod",
"uniprot_ids": [
"P81270"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q08481",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "CD31",
"type": "geneprod",
"uniprot_ids": [
"Q08481"
]
}
] |
||
10.15252/embj.2019102930
|
RhoJ integrates attractive and repulsive cues in directional migration of endothelial cells
|
2020
|
Figure 7
|
<sd-panel> <p><strong>Figure 7. RhoJ-deficiency delays vascular development and suppresses pathological angiogenesis.</strong></p> <ol type="A"> <li> <p>Labeling for GFP (green) and CD31 (red) in retina <strong>of P4</strong> <em>Rhoj<sup>GFP/GFP</sup></em> mouse. Scale bar, 200 µm (left); 20 µm (right).</p> </li> <li> <p>Labeling for EdU (green), ERG (red), and CD31 (gray) in retinas of P4 <em>Rhoj<sup>WT/WT</sup></em> and <em>Rhoj<sup>GFP/GFP</sup></em> mice 2 h after i.p. EdU injections. Scale bar, 20 µm. The graph shows EC proliferation index in retinal capillaries behind the angiogenic fronts. <em>n</em> = 12 per group.</p> </li> <li> <p><strong>Labeling for</strong> CD31 in retinas of P4 and P7 <em>Rhoj<sup>WT/WT</sup></em> and <em>Rhoj<sup>GFP/GFP</sup></em> mice. Scale bars, 500 µm.</p> </li> <li> <p>Morphometric analyses of retinal vessels in <em>Rhoj<sup>WT/WT</sup></em> (P4, <em>n =</em> 18; P7, n = 8) and <em>Rhoj<sup>GFP/GFP</sup></em> (P4, <em>n</em> = 16; P7, <em>n</em> = 11) mice.</p> </li> <li> <p>Labeling for CD31 in retinas of P4 <em>Rhoj<sup>flox/flox</sup></em> and <em>Pdgfb-iCreERT2:Rhoj<sup>flox/flox</sup></em> (<em>Rhoj<sup>iΔEC</sup></em>) mice after single i.p. injection of 100 µg of 4OHT at P1. Scale bar, 500 µm.</p> </li> <li> <p>Morphometric analyses of retinal vessels in P4 <em>Rhoj<sup>flox/flox</sup></em> (<em>n</em> = 7) and <em>Rhoj<sup>i∆EC</sup></em> (<em>n</em> = 6) mice.</p> </li> <li> <p>Relative expression levels of <em>Vegfa</em> and <em>Sema3e</em> mRNA from <em>WT</em> mouse retinas. <em>n</em> = 3 per group.</p> </li> <li> <p>Labeling for GFP (green) and CD31 (red) in retina of P18 OIR-<em>Rhoj<sup>GFP/WT</sup></em> mouse. Scale bar, 200 µm.</p> </li> <li> <p>Labeling for CD31 in retinas of P18 OIR-<em>Rhoj<sup>flox/flox</sup></em> and OIR-<em>Rhoj<sup>i∆EC</sup></em> mice after daily i.p. injection of 200 µg of 4OHT from P12. Scale bar, 500 µm.</p> </li> <li> <p>Quantification of areas of neovascular tufts in P18 OIR-<em>Rhoj<sup>flox/flox</sup></em> and OIR-<em>Rhoj<sup>i∆EC</sup></em> mice. <em>n</em> = 6 per group.</p> </li> </ol> <p>Data information: Data represent mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001; NS, not significant, by Mann-Whitney <em>U</em>-test (B, D, F, and J) and Student's <em>t</em>-test (G).</p> <p><strong><br> Expanded View Figure legends</strong></p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=32334
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q08481",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "CD31",
"type": "geneprod",
"uniprot_ids": [
"Q08481"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P81270",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ERG",
"type": "geneprod",
"uniprot_ids": [
"P81270"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q08481",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "CD31",
"type": "geneprod",
"uniprot_ids": [
"Q08481"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q08481",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "CD31",
"type": "geneprod",
"uniprot_ids": [
"Q08481"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q08481",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "CD31",
"type": "geneprod",
"uniprot_ids": [
"Q08481"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P70275",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Sema3e",
"type": "geneprod",
"uniprot_ids": [
"P70275"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q00731",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Vegfa",
"type": "geneprod",
"uniprot_ids": [
"Q00731"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q08481",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "CD31",
"type": "geneprod",
"uniprot_ids": [
"Q08481"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "80837",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "80837",
"original_type": "gene",
"role": "intervention",
"text": "Rhoj",
"type": "geneprod",
"uniprot_ids": [
"Q9ER71"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q08481",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "CD31",
"type": "geneprod",
"uniprot_ids": [
"Q08481"
]
}
] |
||
24013556
|
10.1038/ncomms3428
|
Bit-by-bit autophagic removal of parkin-labelled mitochondria
|
2013
|
f1
|
<p>(<b>a</b>) Mitochondrial tubules in HeLa cells (top, <named-entity id="named-entity-183">TMRE</named-entity> stained) exceeded the dimensions of that for autophagosomes (labelled by EGFP-<named-entity id="named-entity-184">LC3B</named-entity>) under either normal (middle, same field as <named-entity id="named-entity-185">TMRE</named-entity> image) or starvation conditions (right). (<b>b</b>) Diagram of light-induced mitophagy. Single mitochondrial tubules containing KR-dMito, when illuminated by 559 nm light, are selectively impaired, leading to surface recruitment of <named-entity id="named-entity-186">parkin</named-entity> and subsequent autophagic turnover. (<b>c</b>) Illuminating a selective region (white dotted circle, top) within a KR-dMito/EBFP2-<named-entity id="named-entity-187">parkin</named-entity>-expressing HeLa cell led to the immediate loss of KR fluorescence (top two panels). Third to fifth row: magnified view of the photo-impaired region, EBFP2-<named-entity id="named-entity-188">parkin</named-entity> translocated onto impaired mitochondrial tubules synchronously (38–60 min after 559 illumination, white arrows). Scale bars (all panels), 10 μm.</p>
|
https://api.sourcedata.io/file.php?figure_id=3343
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9GZQ8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3B",
"type": "geneprod",
"uniprot_ids": [
"Q9GZQ8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
}
] |
|
24013556
|
10.1038/ncomms3428
|
Bit-by-bit autophagic removal of parkin-labelled mitochondria
|
2013
|
f2
|
<p>(<b>a</b>) A HeLa cell expressing KR-dMito, EGFP-<named-entity id="named-entity-190">LC3B</named-entity> and EBFP2-<named-entity id="named-entity-191">parkin</named-entity> (cyan) were 559 nm illuminated (white dotted circle region; immediate loss of KR fluorescence). (<b>b</b>–<b>d</b>) Magnified view of the photo-inactivated region in <b>a</b> 34–93 min after 559 nm illumination. (<b>b</b>) Induction of <named-entity id="named-entity-192">parkin</named-entity>-mediated mitophagy on a single, long mitochondria tubule (white arrows). (<b>c</b>) <named-entity id="named-entity-193">LC3B</named-entity>-coated structures were recruited onto distinct spots on the photo-impaired mitochondrial tubule (white arrows: the location of the original impaired single mitochondrial tubule). (<b>d</b>) White dotted line region outlined in <b>c</b>, <named-entity id="named-entity-194">LC3</named-entity> structures segregated from the main <named-entity id="named-entity-195">parkin</named-entity>-labelled cluster, carrying away bits of the <named-entity id="named-entity-196">parkin</named-entity>-labelled mitochondria with them. Two individual events are labelled in the image sequence with white and yellow arrows, respectively. Scale bars (all panels), 5 μm.</p>
|
https://api.sourcedata.io/file.php?figure_id=3344
|
[
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9H492///Q9BXW4///Q9GZQ8",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9GZQ8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3B",
"type": "geneprod",
"uniprot_ids": [
"Q9GZQ8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9GZQ8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3B",
"type": "geneprod",
"uniprot_ids": [
"Q9GZQ8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
}
] |
|
24013556
|
10.1038/ncomms3428
|
Bit-by-bit autophagic removal of parkin-labelled mitochondria
|
2013
|
f3
|
<p>(<b>a</b>) A HeLa cell expressing KR-dMito (red), EGFP-<named-entity id="named-entity-198">DFCP1</named-entity> (green) and EBFP2-<named-entity id="named-entity-199">parkin</named-entity> (cyan) were illuminated with 559 nm at the white dotted circle region, leading to the generation of a long <named-entity id="named-entity-200">parkin</named-entity>-labelled mitochondria tubule (right, magnified view of the light-activated region) for autophagic turnover (white arrow). Scale bars, 10 μm. (<b>b</b>) After the generation of <named-entity id="named-entity-201">parkin</named-entity>-labelled mitochondrial tubules following treatments in <b>a</b>, discrete <named-entity id="named-entity-202">DFCP1</named-entity> foci (green, middle panel, ER-associated omegasomes) formed along the <named-entity id="named-entity-203">parkin</named-entity>-labelled mitochondria (white arrows indicate <named-entity id="named-entity-204">DFCP1</named-entity> spots that colocalized with <named-entity id="named-entity-205">parkin</named-entity>). Bottom panel: merged image of <named-entity id="named-entity-206">parkin</named-entity> and <named-entity id="named-entity-207">DFCP1</named-entity>. Scale bar, 10 μm. (<b>c</b>) Time-lapse imaging showing DCFP1 puncta formation on <named-entity id="named-entity-208">parkin</named-entity>-labelled mitochondria. A HeLa cell expressing KR-dMito, EGFP-<named-entity id="named-entity-209">DFCP1</named-entity> (green) and EBFP2-<named-entity id="named-entity-210">parkin</named-entity> (pseudo-coloured red) were 559 nm illuminated, leading to the generation of <named-entity id="named-entity-211">parkin</named-entity>-labelled mitochondria tubules. Time-lapse imaging (1 frame per min) revealed that <named-entity id="named-entity-212">DFCP1</named-entity> puncta (green) formed transiently at discrete sites on <named-entity id="named-entity-213">parkin</named-entity>-labelled mitochondrial tubules (red). White arrows mark two <named-entity id="named-entity-214">DFCP1</named-entity> puncta (ER-associated omegasomes) formation/disassembly events directly on <named-entity id="named-entity-215">parkin</named-entity>-labelled tubules. Scale bar, 5 μm. (<b>d</b>) A COS-7 cell expressing EBFP2-<named-entity id="named-entity-216">parkin</named-entity> (cyan), AcGFP-<named-entity id="named-entity-217">sec61β</named-entity> (green) and TagRFP-<named-entity id="named-entity-218">DFCP1</named-entity> (red) were treated with 10 μM <named-entity id="named-entity-219">CCCP</named-entity> for 4 h and imaged. Omegasomes (<named-entity id="named-entity-220">DFCP1</named-entity>) appeared where ER (<named-entity id="named-entity-221">sec61β</named-entity>) and impaired mitochondria (<named-entity id="named-entity-222">parkin</named-entity>) overlap. Scale bar, 10 μm. (<b>e</b>) Histogram of the lifetime of individual <named-entity id="named-entity-223">DFCP1</named-entity> foci on <named-entity id="named-entity-224">parkin</named-entity>-labelled mitochondria in <named-entity id="named-entity-225">CCCP</named-entity>-treated HeLa cells expressing TagRFP-<named-entity id="named-entity-226">DFCP1</named-entity>, EGFP-<named-entity id="named-entity-227">LC3B</named-entity> and EBFP2-<named-entity id="named-entity-228">parkin</named-entity>. (<b>f</b>) <named-entity id="named-entity-229">Wortmannin</named-entity> treatments delayed the initial <named-entity id="named-entity-230">LC3</named-entity> recruitment times onto <named-entity id="named-entity-231">parkin</named-entity>-labelled mitochondria in HeLa cells expressing KR-dMito, EGFP-<named-entity id="named-entity-232">LC3B</named-entity> and EBFP2-<named-entity id="named-entity-233">parkin</named-entity>. Each ‘+’ marks the times measured in individual HeLa cells (the red ‘□’ (square) denotes the average from five cells). <i>P</i>=0.0172 (Student’s <i>t</i>-test).</p>
|
https://api.sourcedata.io/file.php?figure_id=3345
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9HBF4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DFCP1",
"type": "geneprod",
"uniprot_ids": [
"Q9HBF4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9HBF4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DFCP1",
"type": "geneprod",
"uniprot_ids": [
"Q9HBF4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9HBF4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DFCP1",
"type": "geneprod",
"uniprot_ids": [
"Q9HBF4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9HBF4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DFCP1",
"type": "geneprod",
"uniprot_ids": [
"Q9HBF4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9HBF4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DCFP1",
"type": "geneprod",
"uniprot_ids": [
"Q9HBF4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9HBF4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DFCP1",
"type": "geneprod",
"uniprot_ids": [
"Q9HBF4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9HBF4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DFCP1",
"type": "geneprod",
"uniprot_ids": [
"Q9HBF4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9HBF4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DFCP1",
"type": "geneprod",
"uniprot_ids": [
"Q9HBF4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P60468",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "sec61β",
"type": "geneprod",
"uniprot_ids": [
"P60468"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9HBF4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DFCP1",
"type": "geneprod",
"uniprot_ids": [
"Q9HBF4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9GZQ8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3B",
"type": "geneprod",
"uniprot_ids": [
"Q9GZQ8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9HBF4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DFCP1",
"type": "geneprod",
"uniprot_ids": [
"Q9HBF4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9HBF4",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "DFCP1",
"type": "geneprod",
"uniprot_ids": [
"Q9HBF4"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9H492///Q9BXW4///Q9GZQ8",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9GZQ8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3B",
"type": "geneprod",
"uniprot_ids": [
"Q9GZQ8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
}
] |
|
24013556
|
10.1038/ncomms3428
|
Bit-by-bit autophagic removal of parkin-labelled mitochondria
|
2013
|
f4
|
<p>(<b>a</b>) A COS-7 cell expressing EBFP2-Ub (red), AcGFP-<named-entity id="named-entity-234">sec61β</named-entity> (green) and mcherry-<named-entity id="named-entity-235">parkin</named-entity> (cyan) was treated with 10 μM <named-entity id="named-entity-236">CCCP</named-entity> for 1 h and imaged. Impaired mitochondria (<named-entity id="named-entity-237">parkin</named-entity>) displayed preferentially ubiquitinated foci (white arrows) at selected regions that overlap with the ER (<named-entity id="named-entity-238">sec61β</named-entity>). (<b>b</b>) HeLa cells expressing KR-dMito (red), EGFP-<named-entity id="named-entity-239">LC3</named-entity> (green) and EBFP2-<named-entity id="named-entity-240">parkin</named-entity> (cyan) were illuminated with 559 nm at the white dotted square regions, generating <named-entity id="named-entity-241">parkin</named-entity>-labelled mitochondria (bottom right, magnified view of the light-activated regions). (<b>c</b>) Magnified view of the photo-inactivated region in <b>b</b> 80 min after illumination (post-stained with anti-ubiquitin antibody). <named-entity id="named-entity-242">LC3</named-entity> and ubiquitin colocalized at discrete sites along <named-entity id="named-entity-243">parkin</named-entity>-labelled mitochondria (white arrows). (<b>d</b>) A <named-entity id="named-entity-244">MG-132</named-entity> treated HeLa cell expressing KR-dMito, EBFP2-<named-entity id="named-entity-245">parkin</named-entity> (green) and EGFP-<named-entity id="named-entity-246">LC3B</named-entity> (red) was 559 nm illuminated, leading to the appearance of <named-entity id="named-entity-247">parkin</named-entity>-labelled mitochondria (white arrows one to three indicated structures, top panels). The <named-entity id="named-entity-248">parkin</named-entity>-labelled structures did not fragment nor became engulfed by <named-entity id="named-entity-249">LC3</named-entity> structures (bottom panels) in the presence <named-entity id="named-entity-250">MG-132</named-entity>. Scale bars (all panels), 5 μm.</p>
|
https://api.sourcedata.io/file.php?figure_id=3346
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot///Uniprot",
"ext_ids": "P62979///P62987///P0CG48///P0CG47",
"ext_tax_ids": "9606///9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Ub",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P60468",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "sec61β",
"type": "geneprod",
"uniprot_ids": [
"P60468"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9H492///Q9BXW4///Q9GZQ8",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9H492///Q9BXW4///Q9GZQ8",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot///Uniprot",
"ext_ids": "P62979///P62987///P0CG48///P0CG47",
"ext_tax_ids": "9606///9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ubiquitin",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot///Uniprot",
"ext_ids": "P62987///P62979///P0CG48///P0CG47",
"ext_tax_ids": "9606///9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ubiquitin",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot///Uniprot///Uniprot",
"ext_ids": "Q9H492///Q9BXW4///Q9GZQ8",
"ext_tax_ids": "9606///9606///9606",
"ext_tax_names": "Homo sapiens///Homo sapiens///Homo sapiens",
"mapping_source": "unknown",
"mapping_status": "unmapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9GZQ8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LC3B",
"type": "geneprod",
"uniprot_ids": [
"Q9GZQ8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O60260",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "parkin",
"type": "geneprod",
"uniprot_ids": [
"O60260"
]
}
] |
|
30692134
|
10.15252/embj.2018100989
|
Abnormal TDP-43 function impairs activity-dependent BDNF secretion, synaptic plasticity and...
|
2018
|
Figure 1
|
<sd-panel> <p><strong>Figure 1. <em>Tardbp</em> knockdown induces production of a soluble form of Sortilin that impairs BDNF sorting to the regulated pathway and activity-dependent secretion in mouse hippocampal neurons</strong></p> <ol type="A"> <li> <p>Expression of <em>Tardbp</em>, total <em>Sort1</em> and exon 17b <em>Sort1</em> mRNAs quantified by Q-PCR in primary hippocampal neurons infected with either scrambled or <em>Tardbp</em> shRNA lentiviruses. Values were first normalized to <em>Gapdh</em> mRNA levels, then plotted as average ± SEM relative to the value of scrambled shRNA (N=3 independent experiments; n=3 wells per condition in each experiment). ***, p<0.001.</p> </li> <li> <p>Western blots of cell lysates and culture supernatants showing TDP-43 and Sortilin expression in primary hippocampal neurons infected with scrambled or <em>Tardbp</em> shRNA lentiviruses. Uninfected cultures were used as an additional control. β-actin immunoblotting and Coomasise Blue staining were used to control equal loading of lysates and supernatants, respectively. Molecular weights are indicated in kDa.</p> </li> <li> <p>Representative photomicrographs of cultured hippocampal neurons infected with scrambled or <em>Tardbp</em> shRNA lentiviruses, immunolabled for BDNF (green), SCG2 (red) and counterstained with DAPI (blue) in orthogonal views (dashed lines) showing colocalization of BDNF and SCG2 in the soma (white arrows).</p> </li> <li> <p>Colocalization between BDNF and SCG2-positive vesicles expressed as percentage of total BDNF immunoreactivity ±SEM in cultured hippocampal neurons infected with scrambled or <em>Tardbp</em> shRNA lentiviruses (N=3 independent experiments, n>50 individual cells per condition in each experiment). **, p<0.01.</p> </li> <li> <p>Colocalization between BDNF and SCG2-positive vesicles in hippocampal neurons infected with scrambled or <em>Tardbp</em> shRNA lentiviruses together with either EGFP or Sortilin rescue viruses. Histogram bars show average ± SEM BDNF/SCG2 colocalization expressed as percentage of total BDNF immunoreactivity (N=3 independent experiments, n>50 individual cells per condition in each experiment). **, p<0.01.</p> </li> <li> <p>BDNF secretion induced by KCl treatment assessed by in-situ BDNF ELISA in cultured hippocampal neurons infected with scrambled or Tardbp shRNA lentiviruses. Histogram bars show average ± SEM BDNF levels normalized to a standard curve (N=3 independent experiments; n=3 wells per condition in each experiment). *, p<0.05; ***, p<0.001.</p> </li> <li> <p>BDNF secretion in cultured hippocampal neurons infected with scrambled (left) or <em>Tardbp</em> (right) shRNA lentiviruses together with either EGFP, <em>Sort1</em> shRNA or Sortilin rescue viruses. Histogram bars show average ± SEM BDNF levels normalized to a standard curve (N=3 independent experiments; n=3 wells per condition in each experiment). ***, p<0.001.</p> </li> </ol> <p>Data information: Results are presented as average ± standard error of the mean (SEM). All statistical tests were performed using 2-way ANOVA with Sidak post hoc analysis.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=24487
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "assayed",
"text": "Sort1",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "assayed",
"text": "Sort1",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "assayed",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q6PHU5",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Sortilin",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q921F2",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q921F2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q03517",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SCG2",
"type": "geneprod",
"uniprot_ids": [
"Q03517"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q03517",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SCG2",
"type": "geneprod",
"uniprot_ids": [
"Q03517"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q03517",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SCG2",
"type": "geneprod",
"uniprot_ids": [
"Q03517"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "intervention",
"text": "Sortilin",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q03517",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SCG2",
"type": "geneprod",
"uniprot_ids": [
"Q03517"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q03517",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SCG2",
"type": "geneprod",
"uniprot_ids": [
"Q03517"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "intervention",
"text": "Sort1",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "intervention",
"text": "Sortilin",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
}
] |
|
30692134
|
10.15252/embj.2018100989
|
Abnormal TDP-43 function impairs activity-dependent BDNF secretion, synaptic plasticity and...
|
2018
|
Figure 2
|
<sd-panel> <p><strong>Figure 2. CA1-specific knockout of TDP-43 increases levels of exon 17b <em>Sort1</em> mRNA and soluble Sortilin protein</strong></p> <ol type="A"> <li> <p>Representative photomicrographs of TDP-43 (green) and NeuN (red) immunohistochemistry in hippocampal CA1 of <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice. Arrows denote areas of depleted TDP-43 immunoreactivity in the mutant.</p> </li> <li> <p>Percentage of TDP-43 positive cells relative to NeuN cells in CA1 and the remaining hippocampus (HC [-CA1]) of <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice. Results are presented as average ± SEM (N=3 mice per condition; 5 sections per mouse). **, p<0.01.</p> </li> <li> <p>TDP-43 intensity in TDP-43/NeuN double-positive cells in CA1 and the remaining hippocampus of <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice. Results are presented as average ± SEM (N=3 mice per condition; 5 sections per mouse). *, p<0.05; **, p<0.01.</p> </li> <li> <p>Expression of <em>Tardbp</em> mRNA in micro-dissected CA1 and the remaining hippocampus of <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice quantified by Q-PCR. Results are presented as average ± SEM relative to levels in <em>Tardbp</em><sup>fx/fx</sup> mice, after normalization to <em>Gapdh</em> mRNA. (N=3 mice per condition; **, p<0.01).</p> </li> <li> <p>Western blots of micro-dissected CA1 and the remaining hippocampus showing expression of TDP-43, full-length and truncated (soluble) Sortilin, and GAPDH in <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice. Bands corresponding to soluble Sortilin are indicated (black arrows). GAPDH immunoblotting was used to control for equal loading. Molecular weights are indicated in kDa.</p> </li> <li> <p>TDP-43 expression in micro-dissected CA1 and the remaining hippocampus of <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice. Results are presented as average ± SD of densitometry relative to GAPDH (N=3 mice per condition; **, p<0.01).</p> </li> <li> <p>Expression of exon 17b <em>Sort1</em> and total <em>Sort1</em> mRNAs in micro-dissected CA1 and the remaining hippocampus of <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice quantified by Q-PCR. Results are presented as average ± SD relative to levels in <em>Tardbp</em><sup>fx/fx</sup> mice, after normalization to <em>Gapdh</em> mRNA. (N=3 mice per condition; **, p<0.01).</p> </li> <li> <p>Expression of full-length (left) and truncated (soluble, right) Sortilin protein in micro-dissected CA1 and the remaining hippocampus of <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice. Results are presented as average ± SD of densitometry relative to GAPDH (N=3 mice per condition; **, p<0.01).</p> </li> </ol> <p>Data information: Results are presented as average ± standard error of the mean (SEM). All statistical tests were performed using 2-way ANOVA with Sidak post hoc analysis.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=24488
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8BIF2",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "NeuN",
"type": "geneprod",
"uniprot_ids": [
"Q8BIF2"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q921F2",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q921F2"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q921F2",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q921F2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q921F2",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q921F2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q921F2",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q921F2"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q921F2",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q921F2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "assayed",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q6PHU5",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Sortilin",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q6PHU5",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Sortilin",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q921F2",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q921F2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q921F2",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q921F2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "assayed",
"text": "Sort1",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "assayed",
"text": "Sort1",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q6PHU5",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Sortilin",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
}
] |
|
30692134
|
10.15252/embj.2018100989
|
Abnormal TDP-43 function impairs activity-dependent BDNF secretion, synaptic plasticity and...
|
2018
|
Figure 3
|
<sd-panel> <p><strong>Figure 3. CA1-specific knockout of TDP-43 reduces dendrite complexity and spine number through altered Sortilin splicing</strong></p> <ol type="A"> <li> <p>Representative photomicrograph of Golgi staining in hippocampus of a <em>Tardbp</em><sup>fx/fx</sup> mouse.</p> </li> <li> <p>Sholl analysis of apical and basal dendritic arbors of CA1 pyramidal neurons from <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice. Results are presented as average ± SEM (N=3 mice per condition, 20 neurons per mouse). *, p<0.05; **, p<0.01.</p> </li> <li> <p>High-magnification representative photomicrograph of Golgi staining of the dendritic arbour of a CA1 pyramidal neuron in a <em>Tardbp</em><sup>fx/fx</sup> mouse. Black arrows denote selected dendritic spines.</p> </li> <li> <p>Spine density in apical and basal dendrites of CA1 pyramidal neurons of <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice. Results are presented as average ± SD (N=3 mice per condition, 15 sections per mouse; *, p<0.05; **, p<0.01).</p> </li> <li> <p>Representative photomicrographs of a <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> hippocampus after stereotaxic injection of EGFP-expressing lentivirus immunostained for EGFP (green) and NeuN (red), and counterstained with DAPI (blue). The injected area within CA1 is indicated in the merged panel.</p> </li> <li> <p>Expression of <em>Tardbp</em> (left), total <em>Sort1</em> (center) and exon 17b <em>Sort1</em> (right) mRNAs quantified by Q-PCR in micro-dissected CA1 of <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice after injection of EGFP-expressing lentivirus or Sortilin rescue virus. Results are presented as average ± SEM relative to levels in <em>Tardbp</em><sup>fx/fx</sup> mice injected with EGFP virus, after normalization to <em>Gapdh</em> mRNA. (N=3 mice per condition). **, p<0.01.</p> </li> <li> <p>Spine density in apical dendrites of CA1 pyramidal neurons of <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice after injection of EGFP-expressing lentivirus or Sortilin rescue virus. Results are presented as average ± SEM (N=3 mice per condition, 15 sections per mouse). **, p<0.01.</p> </li> </ol> <p>Data information: Results are presented as average ± standard error of the mean (SEM). All statistical tests were performed using 2-way ANOVA with Sidak post hoc analysis.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=24489
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8BIF2",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "NeuN",
"type": "geneprod",
"uniprot_ids": [
"Q8BIF2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "assayed",
"text": "Sort1",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "assayed",
"text": "Sort1",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "intervention",
"text": "Sortilin",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "assayed",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "intervention",
"text": "Sortilin",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
}
] |
|
30692134
|
10.15252/embj.2018100989
|
Abnormal TDP-43 function impairs activity-dependent BDNF secretion, synaptic plasticity and...
|
2018
|
Figure 4
|
<sd-panel> <p><strong>Figure 4. CA1-specific knockout of TDP-43 impairs spatial memory and abolishes BDNF-dependent TBS-LTP through altered Sortilin splicing</strong></p> <ol type="A"> <li> <p>Percentage of change in field excitatory postsynaptic potential (fEPSP) recorded from hippocampal area CA1 after theta-burst stimulation (TBS) in Schaffer collaterals of hippocampal slices from <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice. Results are presented as average normalised to t=0 ± SEM (N=7 slices from 3 mice per condition). *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001. Representative traces are shown in Figure S4A.</p> </li> <li> <p>Percentage fEPSP change in CA1 after TBS in Schaffer collaterals of hippocampal slices from <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice stereotactically injected with EGFP-expressing lentivirus or Sortilin rescue virus (red) superimposed to the same data shown in panel (a) (black). Results are presented as average normalised to t=0 ± SEM (N=7 slices from 3 mice per condition). *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001. Representative traces are shown in Figure S4B.</p> </li> <li> <p>Percentage fEPSP change in CA1 after TBS in Schaffer collaterals of hippocampal slices from <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice under control conditions (black) or with BDNF (200ng/ml) perfused from t=0 (green). Results are presented as average normalised to t=0 ± SEM (N=7 slices from 3 mice per condition). *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001. Representative traces are shown in Figure S4C.</p> </li> <li> <p>Percentage of total time spent in the target quadrant or in the remaining three quadrants of the Barnes maze for <em>Tardbp</em><sup>fx/fx</sup> and <em>CamKIIa</em><sup>CRE</sup>;<em>Tardbp</em><sup>fx/fx</sup> mice at 3 different probe times: 20-30 min after first training session (short-term memory) and 24h or 14 days after last training session (long-term or remote memory, respectively). Results are presented as average ± SEM (N=8 mice per condition; * p < 0.05, ** p < 0.01, *** p < 0.001).</p> </li> </ol> <p>Data information: Results are presented as average ± standard error of the mean (SEM). All statistical tests were performed using 2-way ANOVA with Sidak post hoc analysis.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=24490
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "intervention",
"text": "Sortilin",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "intervention",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
}
] |
|
30692134
|
10.15252/embj.2018100989
|
Abnormal TDP-43 function impairs activity-dependent BDNF secretion, synaptic plasticity and...
|
2018
|
Figure 5
|
<sd-panel> <p><strong>Figure 5. Aggregation of TDP-43 impairs activity-dependent BDNF secretion through altered Sortilin splicing</strong></p> <ol type="A"> <li> <p>Representative photomicrographs of cultured hippocampal neurons immunostained for TDP-43 (green), FLAG (red) and counterstained with DAPI (blue) in control conditions (untransduced) or infected with lentivirus expressing FLAG-tagged human TDP-43 12xQN construct.</p> </li> <li> <p>TDP-43 intensity in cell nuclei of untransduced or TDP-43 12xQN-infected hippocampal neurons normalized to mean nuclear intensity in untransduced neurons. Results are presented as average ± SEM (N=3 independent experiments; n=3 wells per condition in each experiment). Student's t-test; **, p<0.01.</p> </li> <li> <p>Expression of <em>Tardbp</em> (left), total <em>Sort1</em> (center) and exon 17b <em>Sort1</em> (right) mRNAs quantified by Q-PCR in hippocampal neurons untransduced (control) or infected with lentiviruses expressing <em>Tardbp</em> shRNA or human TDP-43 12xQN constructs. Values were first normalized to <em>Gapdh</em> mRNA levels, then plotted as average ± SEM relative to levels in untransduced neurons (N=3 independent experiments; n=3 wells per condition in each experiment). 1-way ANOVA with Tukey's post-hoc; **, p<0.01.</p> </li> <li> <p>BDNF secretion induced by KCl treatment as assessed by <em>in-situ</em> BDNF ELISA in cultured hippocampal neurons untransduced (control) or infected with lentiviruses expressing <em>Tardbp</em> shRNA or human TDP-43 12xQN constructs. Histogram bars show average ± SEM BDNF levels normalized to a standard curve (N=5 independent experiments; n=5 wells per condition in each experiment). **, p<0.01; ***, p<0.001.</p> </li> <li> <p>BDNF secretion in cultured hippocampal neurons untransduced (control) or infected with lentiviruses expressing <em>Tardbp</em> shRNA or human TDP-43 12xQN constructs together with either EGFP or Sortilin rescue viruses. Histogram bars show average ± SEM BDNF levels normalized to a standard curve (N=5 independent experiments; n=5 wells per condition in each experiment). **, p<0.01.</p> </li> <li> <p>Data information: Results are presented as average ± standard error of the mean (SEM). Statistical tests were performed using 2-way ANOVA with Tukey or Sidak post hoc analysis, as indicated.</p> </li> </ol> <p>Data information: Results are presented as average ± standard error of the mean (SEM). All statistical tests were performed using Student's t-test (B) or 2-way ANOVA with Sidak post hoc analysis (all other panels).</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=24491
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "23435",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23435",
"original_type": "gene",
"role": "intervention",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q13148",
"Q9H256"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q921F2",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q921F2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23435",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23435",
"original_type": "gene",
"role": "intervention",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q13148",
"Q9H256"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q13148",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q13148"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "assayed",
"text": "Sort1",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "assayed",
"text": "Sort1",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "assayed",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23435",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23435",
"original_type": "gene",
"role": "intervention",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q13148",
"Q9H256"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23435",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23435",
"original_type": "gene",
"role": "intervention",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q13148",
"Q9H256"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "intervention",
"text": "Sortilin",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23435",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23435",
"original_type": "gene",
"role": "intervention",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q13148",
"Q9H256"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
}
] |
|
30692134
|
10.15252/embj.2018100989
|
Abnormal TDP-43 function impairs activity-dependent BDNF secretion, synaptic plasticity and...
|
2018
|
Figure 6
|
<sd-panel> <p><strong>Figure 6. Disease-associated mutations in TDP-43 increase levels of exon 17b <em>Sort1</em> mRNA and impair activity-dependent BDNF secretion in mouse hippocampal neurons and patient-derived human neurons</strong></p> <ol type="A"> <li> <p>Expression of <em>Tardbp</em> (left), total <em>Sort1</em> (center) and exon 17b <em>Sort1</em> (right) mRNAs quantified by Q-PCR in hippocampal neurons infected with <em>Tardbp</em> shRNA and mutant human <em>TARDBP</em> lentivirus constructs as indicated. Absolute levels of mouse <em>Tardbp</em> and human <em>TARDBP</em> mRNAs were determined using a standard curve (see Methods) and added together to assess total <em>Tardbp</em> mRNA levels relative to control uninfected cells after normalization to <em>Gapdh</em> mRNA. Results are presented as average ± SEM (N=3 independent experiments; n=3 wells per condition in each experiment). *, p<0.05; **, p<0.01.</p> </li> <li> <p>Western blots of cell lysates showing total TDP-43 expression in primary hippocampal neurons infected with <em>Tardbp</em> shRNA and mutant human <em>TARDBP</em> lentivirus constructs as indicated. The antibody used here detects both mouse and human TDP-43 proteins. GAPDH immunoblotting was used to control for equal loading. Molecular weights are noted in kDa. Bands corresponding to mouse and human TDP-43 are indicated.</p> </li> <li> <p>BDNF secretion induced by KCl treatment assessed by <em>in-situ</em> BDNF ELISA in cultured hippocampal neurons infected with <em>Tardbp</em> shRNA and mutant human <em>TARDBP</em> lentivirus constructs as indicated. Histogram bars show average ± SEM BDNF levels normalized to a standard curve (N=5 independent experiments; n=5 wells per condition in each experiment). *, p<0.05; ***, p<0.001</p> </li> <li> <p>BDNF secretion induced by KCl treatment in cultured hippocampal neurons infected with <em>Tardbp</em> shRNA and mutant human <em>TARDBP</em> lentivirus constructs together with either EGFP or Sortilin rescue viruses. Histogram bars show average ± SEM BDNF levels normalized to a standard curve (N=5 independent experiments; n=5 wells per condition in each experiment). *, p<0.05; **, p<0.01.</p> </li> <li> <p>Expression of <em>TARDBP</em> (left), total <em>SORT1</em> (center) and exon 17b <em>SORT1</em> (right) mRNAs quantified by Q-PCR in human neurons derived from the indicated stem cells carrying either wild type Met<sup>337</sup> (grey bars) or disease-associated Val<sup>337</sup> (black bars) <em>TARDBP</em> alleles. Results are presented as average ± SEM (N=3 independent experiments; n=3 wells per condition in each experiment). *, p<0.05; **, p<0.01.</p> </li> <li> <p>BDNF secretion in stem-cell derived human neurons carrying wild type Met<sup>337</sup>or Val<sup>337</sup> <em>TARDBP</em> alleles, infected with proBDNF lentivirus 5 days prior to depolarization by KCl treatment. Results are presented as average ± SEM (N=3 independent experiments; n=5 wells per condition in each experiment). **, p<0.01; ***, p<0.001.</p> </li> </ol> <p>Data information: Results are presented as average ± standard error of the mean (SEM). All statistical tests were performed using 2-way ANOVA with Sidak post hoc analysis.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=24492
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "assayed",
"text": "Sort1",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "assayed",
"text": "Sort1",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23435",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23435",
"original_type": "gene",
"role": "intervention",
"text": "TARDBP",
"type": "geneprod",
"uniprot_ids": [
"Q13148",
"Q9H256"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "assayed",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23435",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23435",
"original_type": "gene",
"role": "assayed",
"text": "TARDBP",
"type": "geneprod",
"uniprot_ids": [
"Q13148",
"Q9H256"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "assayed",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "assayed",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23435",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23435",
"original_type": "gene",
"role": "intervention",
"text": "TARDBP",
"type": "geneprod",
"uniprot_ids": [
"Q13148",
"Q9H256"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q13148",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q13148"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q921F2",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q921F2"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q921F2",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "TDP-43",
"type": "geneprod",
"uniprot_ids": [
"Q921F2"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23435",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23435",
"original_type": "gene",
"role": "intervention",
"text": "TARDBP",
"type": "geneprod",
"uniprot_ids": [
"Q13148",
"Q9H256"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "20661",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "20661",
"original_type": "gene",
"role": "intervention",
"text": "Sortilin",
"type": "geneprod",
"uniprot_ids": [
"Q6PHU5"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "230908",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "230908",
"original_type": "gene",
"role": "intervention",
"text": "Tardbp",
"type": "geneprod",
"uniprot_ids": [
"Q921F2",
"Q544R5",
"Q6VYI4",
"Q6VYI5",
"Q8BLD4",
"Q8BUM1",
"Q8R0B4"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23435",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23435",
"original_type": "gene",
"role": "intervention",
"text": "TARDBP",
"type": "geneprod",
"uniprot_ids": [
"Q13148",
"Q9H256"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P21237",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P21237"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "6272",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "6272",
"original_type": "gene",
"role": "assayed",
"text": "SORT1",
"type": "geneprod",
"uniprot_ids": [
"Q99523"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "6272",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "6272",
"original_type": "gene",
"role": "assayed",
"text": "SORT1",
"type": "geneprod",
"uniprot_ids": [
"Q99523"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23435",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23435",
"original_type": "gene",
"role": "assayed",
"text": "TARDBP",
"type": "geneprod",
"uniprot_ids": [
"Q13148",
"Q9H256"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23435",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23435",
"original_type": "gene",
"role": "intervention",
"text": "TARDBP",
"type": "geneprod",
"uniprot_ids": [
"Q13148",
"Q9H256"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "627",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "627",
"original_type": "gene",
"role": "intervention",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P23560",
"A0A0E3SU01"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "23435",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "23435",
"original_type": "gene",
"role": "intervention",
"text": "TARDBP",
"type": "geneprod",
"uniprot_ids": [
"Q13148",
"Q9H256"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23560",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BDNF",
"type": "geneprod",
"uniprot_ids": [
"P23560"
]
}
] |
|
29101300
|
10.15252/msb.20177701
|
Pharmacoproteomic characterisation of human colon and rectal cancer
|
2017
|
Figure 4
|
<p><strong>Figure 4 - MAP2K1 is a predictive marker for inhibitors targeting EGFR</strong></p>
<p>Effect-size heat maps of six drugs (see titles of panels) targeting EGFR. It is evident that the different drugs showed different profiles but also that high MAP2K1 expression (blue/red gradient across cell lines) was consistently associated with drug resistance (dark blue/yellow gradient across cell lines; AUC: area under the curve; see main text and Appendix for details). See also Figure EV5.</p>
|
https://api.sourcedata.io/file.php?figure_id=16217
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q02750",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "MAP2K1",
"type": "geneprod",
"uniprot_ids": [
"Q02750"
]
}
] |
|
29101300
|
10.15252/msb.20177701
|
Pharmacoproteomic characterisation of human colon and rectal cancer
|
2017
|
Figure 5
|
<p><strong>Figure 5 - MERTK is a predictive marker for inhibitors targeting MEK1/2 in CRC cell lines</strong></p>
<p>(A) Effect-size heat maps of two drugs (one from two different drug sensitivity screens) targeting MEK1/2 show consistent association of high MERTK expression with drug resistance. The colour scheme is the same as in Figure 4.</p>
<p>(B) Bar chart visualising the top kinases recurrently associated (absolute effect-size>0) with drug resistance (top seven bars) and sensitivity (bottom seven bars) in the GDSC and CCLE drug sensitivity datasets.</p>
<p>(C) Dose-response curves of two drugs for which high MERTK (left panels) or ACVR2A (right panels) expression was predicted to confer drug resistance. For each drug, three cell lines predicted to be sensitive (dark blue) and three cell lines predicted to be resistant (yellow) were assayed for viability. The experimental data validated that cell lines predicted to be more sensitive to a drug indeed showed this phenotype (data represents the average of three technical replicates; see Appendix for details).</p>
<p>(D) Boxplots summarizing the data shown in panel (C) using the area under the curve (AUC) as a measure for drug sensitivity. High AUC values indicate drug resistance. Again, it is evident that cell lines predicted to be more resistant to a certain drug were in fact significantly (p≤0.05, one-sided Mann-Whitney test) more resistant than cell lines predicted to be more sensitive.</p>
<p>(E) Western blot of and cells, visualising successful knockout by CRISPR/Cas9.</p>
<p>(F) Dose-response curve of RDEA119 (MEK1/2 inhibitor) in and cells. The knockout is more sensitive to MEK1/2 inhibition than the wild type. See also Figure EV6.</p>
|
https://api.sourcedata.io/file.php?figure_id=16218
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q12866",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "MERTK",
"type": "geneprod",
"uniprot_ids": [
"Q12866"
]
}
] |
|
29101300
|
10.15252/msb.20177701
|
Pharmacoproteomic characterisation of human colon and rectal cancer
|
2017
|
Figure 6
|
<p><strong>Figure 6 - MERTK is a prognostic marker in CRC patients</strong></p>
<p>(A) Western Blot visualising MERTK expression in two negative (RKO, CC07) and two positive control cell lines (CaCo-2; HT55).</p>
<p>(B) IHC staining of MERTK expression in RKO (negative control) and CaCo-2 (positive control) cells.</p>
<p>(C) IHC staining of three representative TMAs from patients enrolled in the QUASAR 2 clinical trial and the corresponding quantification of the signal by pathologists.</p>
<p>(D) Kaplan-Meier plots showing worse overall, disease-free and recurrence-free survival of patients with high cytoplasmic/membranous expression of MERTK.</p>
<p><strong>Expanded View Figure Legends</strong></p>
|
https://api.sourcedata.io/file.php?figure_id=16219
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q12866",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "MERTK",
"type": "geneprod",
"uniprot_ids": [
"Q12866"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q12866",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "MERTK",
"type": "geneprod",
"uniprot_ids": [
"Q12866"
]
}
] |
|
10.15252/embr.201948901
|
TMEM135 regulates primary ciliogenesis through modulation of intracellular cholesterol distribution
|
2020
|
Figure 1
|
<sd-panel> <p><strong>Figure 1. Depletion of TMEM135 results in cholesterol accumulation in lysosomes.</strong></p> <p><strong>(A)</strong> RPE1 cells were transfected with either scramble or TMEM135 siRNAs and immunostained for LAMP1 as a lysosome marker (red) and PMP70 as a peroxisome marker (green). Scale bar, 10 μm.</p> <p><strong>(B)</strong> Quantification of overlap signal between lysosomes and peroxisomes shown in <strong>(A)</strong>. Data represent mean ± SD (n=3 experiments), 50 cells were scored per condition per experiment. <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(C)</strong> Subcellular fractions of a discontinuous sucrose gradient collected from top to bottom, separated by SDS-PAGE, and immunoblotted for LAMP1, EEA1, Rab11, Rab8, PMP70, GM130, and Na<sup>+</sup>/K<sup>+</sup> ATPase.</p> <p><strong>(D)</strong> Quantification of total cholesterol in the subcellular fractions shown in <strong>(C)</strong>. Data represent mean ± SD (n=3 experiments), <strong>*P < 0.05, Student's t-test</strong>.</p> <p><strong>(E)</strong> Cells transfected with TMEM135 siRNA were subjected to a SREBP2 cleavage assay for the precursor of SREBP2 and nuclear SREBP2.</p> <p><strong>(F)</strong> Cells transfected with TMEM135 siRNA were subjected to qPCR. Data represent mean ± SD (n=3 experiments), <strong>*P < 0.05, Student's t-test.</strong></p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=30839
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "65084",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "65084",
"original_type": "gene",
"role": "intervention",
"text": "TMEM135",
"type": "geneprod",
"uniprot_ids": [
"Q86UB9",
"B4DYK0"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P28288",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PMP70",
"type": "geneprod",
"uniprot_ids": [
"P28288"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P11279",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LAMP1",
"type": "geneprod",
"uniprot_ids": [
"P11279"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P28288",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PMP70",
"type": "geneprod",
"uniprot_ids": [
"P28288"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P05023",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Na+/K+ ATPase",
"type": "geneprod",
"uniprot_ids": [
"P05023"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q15075",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "EEA1",
"type": "geneprod",
"uniprot_ids": [
"Q15075"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q08379",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "GM130",
"type": "geneprod",
"uniprot_ids": [
"Q08379"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P11279",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "LAMP1",
"type": "geneprod",
"uniprot_ids": [
"P11279"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P62491",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab11",
"type": "geneprod",
"uniprot_ids": [
"P62491"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "65084",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "65084",
"original_type": "gene",
"role": "intervention",
"text": "TMEM135",
"type": "geneprod",
"uniprot_ids": [
"Q86UB9",
"B4DYK0"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q12772",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SREBP2",
"type": "geneprod",
"uniprot_ids": [
"Q12772"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q12772",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SREBP2",
"type": "geneprod",
"uniprot_ids": [
"Q12772"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q12772",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "SREBP2",
"type": "geneprod",
"uniprot_ids": [
"Q12772"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "65084",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "65084",
"original_type": "gene",
"role": "intervention",
"text": "TMEM135",
"type": "geneprod",
"uniprot_ids": [
"Q86UB9",
"B4DYK0"
]
}
] |
||
10.15252/embr.201948901
|
TMEM135 regulates primary ciliogenesis through modulation of intracellular cholesterol distribution
|
2020
|
Figure 2
|
<sd-panel> <p><strong>Figure 2. Depletion of TMEM135 impairs ciliogenesis through disruption of intracellular cholesterol distribution.</strong></p> <p><strong>(A)</strong> RPE1 cells were transfected with siRNAs as indicated, followed by serum starvation for 24 h, and immunostained for ARL13B (red) and γ-tubulin (green). Scale bar, 10 μm.</p> <p><strong>(B)</strong> Quantification of the percentage of ciliated cells shown in <strong>(A).</strong> Data represent mean ± SD (n=3 experiments), 250 cells were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(C)</strong> Cells were transfected with siRNAs as indicated and incubated with HPβCD in serum-starvation media followed by filipin staining. Scale bar, 20 μm<strong>.</strong></p> <p><strong>(D)</strong> Cells were transfected with siRNAs shown in <strong>(C)</strong> and immunostained for ARL13B (red) and γ-tubulin (green). Scale bar, 10 μm.</p> <p><strong>(E)</strong> Quantification of the percentage of ciliated cells shown in <strong>(D)</strong>. Data represent mean ± SD (n=3 experiments), 250 cells were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(F)</strong> Cells were transfected with siRNAs as indicated, incubated with cholesterol-MβCD complex in serum-starvation media, and immunostained for ARL13B (red) and γ-tubulin (green). Scale bar, 10 μm.</p> <p><strong>(G)</strong> Quantification of the percentage of ciliated cells shown in <strong>(F)</strong>. Data represent mean ± SD (n=3experiments), 250 cells were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=30841
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3SXY8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ARL13B",
"type": "geneprod",
"uniprot_ids": [
"Q3SXY8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23258",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "γ-tubulin",
"type": "geneprod",
"uniprot_ids": [
"P23258"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3SXY8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ARL13B",
"type": "geneprod",
"uniprot_ids": [
"Q3SXY8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23258",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "γ-tubulin",
"type": "geneprod",
"uniprot_ids": [
"P23258"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3SXY8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ARL13B",
"type": "geneprod",
"uniprot_ids": [
"Q3SXY8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23258",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "γ-tubulin",
"type": "geneprod",
"uniprot_ids": [
"P23258"
]
}
] |
||
10.15252/embr.201948901
|
TMEM135 regulates primary ciliogenesis through modulation of intracellular cholesterol distribution
|
2020
|
Figure 3
|
<sd-panel> <p><strong>Figure 3. Depletion of TMEM135 impairs both trafficking and enhanced IFT20 recruitment to centrioles.</strong></p> <p><strong>(A)</strong> RPE1 cells were transfected with siRNA as indicated, and immunostained for Rab8 (red) and γ-tubulin (green) in either 10% FBS medium (upper panel) or serum-starvation medium (lower panel). Scale bar, 10 μm. Arrowhead indicates Rab8 localized to the centrioles.</p> <p><strong>(B)</strong> Quantification of the percentage of cells with Rab8 localized to the centriole shown in <strong>(A)</strong>. Data represent mean ± SD (n=3 experiments), 200 cells were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(C)</strong> Cells were transfected with siRNA shown in <strong>(A)</strong> and immunostained for IFT20 (red) and γ-tubulin (green). Scale bar, 10 μm.</p> <p><strong>(D)</strong> Quantification of the percentage of IFT20 intensity at the centrioles in <strong>(c)</strong>. Data represent mean ± SD (n=3 experiments), 150 cells were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=30843
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23258",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "γ-tubulin",
"type": "geneprod",
"uniprot_ids": [
"P23258"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IY31",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IFT20",
"type": "geneprod",
"uniprot_ids": [
"Q8IY31"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23258",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "γ-tubulin",
"type": "geneprod",
"uniprot_ids": [
"P23258"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IY31",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IFT20",
"type": "geneprod",
"uniprot_ids": [
"Q8IY31"
]
}
] |
||
10.15252/embr.201948901
|
TMEM135 regulates primary ciliogenesis through modulation of intracellular cholesterol distribution
|
2020
|
Figure 4
|
<sd-panel> <p><strong>Figure 4. Ectopic expression of a constitutively active form of Rab8 recovers ciliogenesis in TMEM135-depleted cells.</strong></p> <p><strong>(A)</strong> RPE1 cells were transfected with siRNAs as indicated, followed by transfection with wild-type pGFP-Rab8a (WT-Rab8), constitutively active pGFP-Rab8a (Q67L) (CA-Rab8), or DN Rab8 dominant-negative pGFP Rab8a (T22N), incubated in serum-starved media for 12 h, and immunostained for ARL13B (Red), GFP-Rab8 (green), and DAPI (blue). Scale bar, 10 μm.</p> <p><strong>(B)</strong> Quantification of the percentage of ciliated cells shown in <strong>(A)</strong>. Data represent mean ± SD (n=3 experiments), 200 GFP-positive cells were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(C)</strong> (Upper panel) Cells were transfected as indicated and the cell lysates were incubated with purified proteins, including GST or GST-JCF1 (RBD). The amount of GTP-Rab8 bound to GFT-JCF1(RBD) was analyzed by western blot with Rab8 antibody. (Lower panel) Intensity of the bands was quantified by Image J software. The amount of GTP-Rab8 were normalized to the control level. Bar graph represents mean ± SD (n=3 experiments). <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(D)</strong> Cells were transfected as shown in <strong>(A)</strong> and cell lysates were incubated with purified GST-JCF1 (RBD) fusion protein. The amount of GTP-Rab8 bound to GFT-JCF1(RBD) was analyzed by Western blot with Rab8 antibody. (Lower panel) Cells were transfected as shown in (<strong>A)</strong> and cell lysates were incubated with purified GST- protein. The amount of GTP-Rab8 bound to GFT-JCF1(RBD) was analyzed by Western blot with Rab8 antibody.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=30845
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "4218",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "4218",
"original_type": "gene",
"role": "intervention",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "4218",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "4218",
"original_type": "gene",
"role": "intervention",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "4218",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "4218",
"original_type": "gene",
"role": "intervention",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "4218",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "4218",
"original_type": "gene",
"role": "intervention",
"text": "Rab8a",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "4218",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "4218",
"original_type": "gene",
"role": "intervention",
"text": "Rab8a",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "4218",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "4218",
"original_type": "gene",
"role": "intervention",
"text": "Rab8a",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3SXY8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ARL13B",
"type": "geneprod",
"uniprot_ids": [
"Q3SXY8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IYJ3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "JCF1",
"type": "geneprod",
"uniprot_ids": [
"Q8IYJ3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IYJ3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "JCF1",
"type": "geneprod",
"uniprot_ids": [
"Q8IYJ3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IYJ3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "JCF1",
"type": "geneprod",
"uniprot_ids": [
"Q8IYJ3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IYJ3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "JCF1",
"type": "geneprod",
"uniprot_ids": [
"Q8IYJ3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IYJ3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "JCF1",
"type": "geneprod",
"uniprot_ids": [
"Q8IYJ3"
]
}
] |
||
10.15252/embr.201948901
|
TMEM135 regulates primary ciliogenesis through modulation of intracellular cholesterol distribution
|
2020
|
Figure 5
|
<sd-panel> <p><strong>Figure 5. Malfunctioned ciliogenesis observed during TMEM135 depletion is not associated with IFT20.</strong></p> <p><strong>(A)</strong> RPE1 cells were transfected with siRNAs as indicated, followed by 24 h incubation in serum-starved media. Cells were then and subjected to fractionation, and Western blot for IFT20, the Golgi marker GM130, membrane marker UBXD8, and nuclear marker CREB.</p> <p><strong>(B)</strong> Efficiency of IFT20 knockdown by western blot.</p> <p><strong>(C)</strong> Cells were transfected with siRNAs as indicated, followed by incubation in serum-starved media for 24 h, and immunostained for ARL13B (red). Scale bar, 10 μm. <strong>The bar graph represents the</strong> quantification of the percentage of ciliated cells. Data represent mean ± SD (n=3 experiments), 250 cells were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(D)</strong> Cells were transfected as shown in <strong>(C),</strong> and immunostained for Rab8 and γ-tubulin, followed by quantification of the percentage of cells with Rab8 localized to the centriole. Data represent average (n=2 experiments).</p> <p><strong>(E)</strong> Cells were transfected with siRNAs as indicated, followed by transfection with Flag-IFT20, incubation in serum-starvation media for 12 h, and immunostained for ARL13B. Representative fluorescent images of Flag-IFT20 (green), ARL13B (red), and DAPI (blue) are shown. Scale bar, 10 μm.</p> <p><strong>(F)</strong> Quantification of the percentage of ciliated cells with both the Flag-IFT20 and ARL13B localized in the cilium. Data represent mean ± SD (n=3 experiments), 150 Flag positive cells were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(G)</strong> Cells were transfected with siRNAs as indicated, followed by further transfection with CA-Rab8, incubation in serum-starvation media for 12 h, and immunostained for acetylated-tubulin. Representative fluorescent images of GFP-Rab8 Q67L (green), acetylated-tubulin (red), and DNA (blue) are shown. Scale bar, 10 μm.</p> <p><strong>(H)</strong> Quantification of the percentage of GFP-positive ciliated cells (only those cilia having both GFP-Rab8 and acetylated-tubulin on cilium were considered for quantification). Data represent mean ± SD (n = 3 experiments), 200 GFP positive cells were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=30847
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IY31",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IFT20",
"type": "geneprod",
"uniprot_ids": [
"Q8IY31"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "90410",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "90410",
"original_type": "gene",
"role": "intervention",
"text": "IFT20",
"type": "geneprod",
"uniprot_ids": [
"Q8IY31",
"A0A087X2B4"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3SXY8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ARL13B",
"type": "geneprod",
"uniprot_ids": [
"Q3SXY8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23258",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "γ-tubulin",
"type": "geneprod",
"uniprot_ids": [
"P23258"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3SXY8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ARL13B",
"type": "geneprod",
"uniprot_ids": [
"Q3SXY8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3SXY8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ARL13B",
"type": "geneprod",
"uniprot_ids": [
"Q3SXY8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3SXY8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ARL13B",
"type": "geneprod",
"uniprot_ids": [
"Q3SXY8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q61025",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IFT20",
"type": "geneprod",
"uniprot_ids": [
"Q61025"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q61025",
"ext_tax_ids": "10090",
"ext_tax_names": "Mus musculus",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IFT20",
"type": "geneprod",
"uniprot_ids": [
"Q61025"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P68366",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "tubulin",
"type": "geneprod",
"uniprot_ids": [
"P68366"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P68366",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "tubulin",
"type": "geneprod",
"uniprot_ids": [
"P68366"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P68366",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "tubulin",
"type": "geneprod",
"uniprot_ids": [
"P68366"
]
}
] |
||
10.15252/embr.201948901
|
TMEM135 regulates primary ciliogenesis through modulation of intracellular cholesterol distribution
|
2020
|
Figure 6
|
<sd-panel> <p><strong>Figure 6. Enhanced IFT20 intensity induced by serum starvation at centrioles depends on Rab8 activation.</strong></p> <p><strong>(A)</strong> Efficiency of Rab8a depletion confirmed by Western blot in RPE1 cells.</p> <p><strong>(B)</strong> RPE1 cells were transfected by siRNAs as indicated, followed by incubation in serum-starvation media for 24 h, and immunostained for ARL13B (red) and γ-tubulin (green). Scale bar, 10 μm.</p> <p><strong>(C)</strong> Quantification of the percentage of ciliated cells shown in <strong>(B)</strong> Data represent mean ± SD (n = 3 experiments), 250 GFP positive cells were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(D)</strong> Cells were transfected by siRNa as indicated followed by incubation in serum-starvation media for 24 h, and immunostained for EHD1 (red) and γ-tubulin (green). Scale bar, 10 μm.</p> <p><strong>(E)</strong> Quantification of the percentage of cells with EHD1 in cilium or in the distal end of basal body as shown in <strong>(D)</strong>. Data represent mean ± SD (n=3 experiments), 150 cells were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(F)</strong> Cells were transfected by siRNAs as indicated, followed by incubation in serum-starvation media for 24 h, and immunostained for IFT20 (red) and γ-tubulin (green). Scale bar, 10 μm.</p> <p><strong>(G)</strong> Quantification of the percentage of IFT20 fluorescent intensity at the centriole shown in <strong>(F)</strong>. Data represent mean ± SD (n=3 experiments), 150 were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(H, I, J)</strong> Cells were transfected by siRNAs as indicated, followed by transfection with GFP-Rab8 WT, GFP-Rab8 Q67L, or GFP-Rab8 T22N, and further incubated in serum-starvation media for 12 h. Cell lysate was subjected to immunoprecipitation with anti-GFP antibody, followed by Western blot with antibody against GFP.</p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=30849
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "4218",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "4218",
"original_type": "gene",
"role": "intervention",
"text": "Rab8a",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q3SXY8",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "ARL13B",
"type": "geneprod",
"uniprot_ids": [
"Q3SXY8"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23258",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "γ-tubulin",
"type": "geneprod",
"uniprot_ids": [
"P23258"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H4M9",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "EHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9H4M9"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9H4M9",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "EHD1",
"type": "geneprod",
"uniprot_ids": [
"Q9H4M9"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23258",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "γ-tubulin",
"type": "geneprod",
"uniprot_ids": [
"P23258"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IY31",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IFT20",
"type": "geneprod",
"uniprot_ids": [
"Q8IY31"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IY31",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IFT20",
"type": "geneprod",
"uniprot_ids": [
"Q8IY31"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23258",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "γ-tubulin",
"type": "geneprod",
"uniprot_ids": [
"P23258"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "4218",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "4218",
"original_type": "gene",
"role": "intervention",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "4218",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "4218",
"original_type": "gene",
"role": "intervention",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "4218",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "4218",
"original_type": "gene",
"role": "intervention",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
}
] |
||
10.15252/embr.201948901
|
TMEM135 regulates primary ciliogenesis through modulation of intracellular cholesterol distribution
|
2020
|
Figure 7
|
<sd-panel> <p><strong>Figure 7. Cholesterol-MβCD complex rescues impaired Rab8 trafficking to the centriole, augments Rab8-GTP binding, and increases IFT20 intensity at the centriole in TMEM135-depleted cells.</strong></p> <p><strong>(A)</strong> RPE1 cells were transfected as indicated, followed by incubation in serum-starvation media in the presence or absence of cholesterol/MCD for 24 h, and then immunostained for Rab8 (red) and γ-tubulin (green). Scale bar, 10 μm. Representative magnified images are shown from cells labeled with white asterisks.</p> <p><strong>(B)</strong> Quantification of the percentage of cells with Rab8 localized to the centriole shown in <strong>(A)</strong>. Data represent mean ± SD (n=3 experiments), 200 cells were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(C) (Upper panel)</strong> Cells were transfected as shown in <strong>(A)</strong> and cell lysate was incubated with purified GST-JCF1 (RBD) fusion protein. The amount of GTP-Rab8 bound to GFT-JCF1(RBD) was analyzed by western blot with Rab8 antibody. (Lower panel) The intensity of bands was quantified by Image J software. The amount of GTP-Rab8 were normalized to the control level. The bar graph represents mean ± SD (n=3 experiments). <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(D)</strong> Cells were transfected as shown in <strong>(A)</strong>, and immunostained for IFT20 (red) and γ-tubulin (green). Scale bar, 10 μm.</p> <p><strong>(E)</strong> Quantification of IFT20 intensity at the centriole shown in <strong>(D)</strong>. Data represent mean ± SD (n=3 experiments), 150 cells were scored per condition per experiment, <strong>*P < 0.05, Student's t-test.</strong></p> <p><strong>(F)</strong> A proposed model showing the importance of cholesterol for primary ciliogenesis.</p> <p><strong>Expanded View Figure Legends</strong></p> </sd-panel>
|
https://api.sourcedata.io/file.php?figure_id=30850
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23258",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "γ-tubulin",
"type": "geneprod",
"uniprot_ids": [
"P23258"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P61006",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "Rab8",
"type": "geneprod",
"uniprot_ids": [
"P61006"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IYJ3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "JCF1",
"type": "geneprod",
"uniprot_ids": [
"Q8IYJ3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IYJ3",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "JCF1",
"type": "geneprod",
"uniprot_ids": [
"Q8IYJ3"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IY31",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IFT20",
"type": "geneprod",
"uniprot_ids": [
"Q8IY31"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "P23258",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "γ-tubulin",
"type": "geneprod",
"uniprot_ids": [
"P23258"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q8IY31",
"ext_tax_ids": "9606",
"ext_tax_names": "Homo sapiens",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "IFT20",
"type": "geneprod",
"uniprot_ids": [
"Q8IY31"
]
}
] |
||
10.15252/embj.2020107257
|
The Arabidopsis E3 ubiquitin ligase PUB4 regulates BIK1 and is targeted by a bacterial type-III effector
|
2022
|
Figure 1
|
<p><strong>Figure 1. RipAC inhibits PTI in Arabidopsis</strong></p><p>(A-C) RipAC overexpression inhibits ROS production induced by 50 nM flg22<sup>Pto</sup> (A), 100 nM elf18<sup>Rsol</sup> (B), and 200 μg/mL chitin (C) in Arabidopsis. ROS was measured as relative luminescence units (RLU) over time. Values are means ± SE (n=24 biological replicates).</p><p>(D) RipAC overexpression inhibits flg22-triggered MAPK activation in Arabidopsis. 100 nM flg22<sup>Pto</sup> was used to treat Arabidopsis seedlings and the samples were collected at indicated time points. Immunoblots were analysed using anti-pMAPK and anti-RipAC antibodies. Coomassie brilliant blue (CBB) staining and a non-specific band were used as loading control. Molecular weight (kDa) marker bands are indicated for reference.</p><p>(E) RipAC overexpression lines display elevated susceptibility to <em>Pto</em> DC3000 Δ<em>hrcC</em>, but not to <em>Pto</em> DC3000. Arabidopsis plants were spray-inoculated with indicated <em>Pto</em> strains (5x10<sup>7</sup> CFU mL<sup>-1</sup>) and bacterial titers were determined 3 days post-inoculation. Values are means ± SE (n=6 biological replicates). Asterisks indicate significant differences compared to Col-0 (Student's t test, ** p<0.01).</p><p>Data information: Experiments were performed 3 times with similar results.</p>
|
https://api.sourcedata.io/file.php?figure_id=50308
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "2831203",
"ext_tax_ids": "267608",
"ext_tax_names": "Ralstonia solanacearum GMI1000",
"mapping_source": "unmapped",
"mapping_status": "unmapped",
"ncbi_gene_id": "2831203",
"original_type": "gene",
"role": "intervention",
"text": "RipAC",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "Uniprot",
"ext_ids": "A0A7U7JE71",
"ext_tax_ids": "564066",
"ext_tax_names": "Ralstonia solanacearum IPO1609",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RipAC",
"type": "geneprod",
"uniprot_ids": [
"A0A7U7JE71"
]
}
] |
||
10.15252/embj.2020107257
|
The Arabidopsis E3 ubiquitin ligase PUB4 regulates BIK1 and is targeted by a bacterial type-III effector
|
2022
|
Figure 2
|
<p><strong>Figure 2 RipAC associates with PUB4 in plant cells</strong></p><p>(A-B) Interaction between RipAC and SlPUB4/AtPUB4 was confirmed by Split-LUC assay qualitatively (A) and quantitatively (B) in <em>Nicotiana benthamiana</em>. Values are means ± SE (n=8 biological replicates). Asterisks indicate significant differences compared to RipAC-nLUC/cLUC-AtPIP2A negative control (Student's t test, **** p<0.0001). RLU: relative luminescence units.</p><p>(C) Co-immunoprecipitation of SlPUB4/AtPUB4-GFP and RipAC-nLUC after co-expression in <em>N. benthamiana</em>. Two days after Agrobacterium infiltration, the plant tissues were collected and then subjected to anti-GFP immunoprecipitation. Immunoblots were analyzed using anti-LUC and anti-GFP antibodies. Molecular weight (kDa) marker bands are indicated for reference.</p><p>(D) Interaction between RipAC-RFP and SlPUB4/AtPUB4-GFP determined by FRET-FLIM upon transient co-expression in <em>N. benthamiana</em> leaves. GFP fluorescence lifetime of each GFP fusion protein is shown as a negative control. Lines represent average values (n=5 biological replicates) and error bars represent standard error. (Student's t-test, *** p<0.001).</p><p>Data information: Experiments were performed 3 times with similar results.</p>
|
https://api.sourcedata.io/file.php?figure_id=50309
|
[
{
"ext_dbs": "Uniprot",
"ext_ids": "K4D648",
"ext_tax_ids": "4081",
"ext_tax_names": "Solanum lycopersicum",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PUB4",
"type": "geneprod",
"uniprot_ids": [
"K4D648"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O22193",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PUB4",
"type": "geneprod",
"uniprot_ids": [
"O22193"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "A0A7U7JE71",
"ext_tax_ids": "564066",
"ext_tax_names": "Ralstonia solanacearum IPO1609",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RipAC",
"type": "geneprod",
"uniprot_ids": [
"A0A7U7JE71"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "A0A7U7JE71",
"ext_tax_ids": "564066",
"ext_tax_names": "Ralstonia solanacearum IPO1609",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RipAC",
"type": "geneprod",
"uniprot_ids": [
"A0A7U7JE71"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "K4D648",
"ext_tax_ids": "4081",
"ext_tax_names": "Solanum lycopersicum",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PUB4",
"type": "geneprod",
"uniprot_ids": [
"K4D648"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O22193",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PUB4",
"type": "geneprod",
"uniprot_ids": [
"O22193"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "A0A7U7JE71",
"ext_tax_ids": "564066",
"ext_tax_names": "Ralstonia solanacearum IPO1609",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RipAC",
"type": "geneprod",
"uniprot_ids": [
"A0A7U7JE71"
]
}
] |
||
10.15252/embj.2020107257
|
The Arabidopsis E3 ubiquitin ligase PUB4 regulates BIK1 and is targeted by a bacterial type-III effector
|
2022
|
Figure 3
|
<p><strong>Figure 3. PUB4 positively regulates PTI in Arabidopsis</strong></p><p>(A-D) ROS burst in Col-0 WT or the indicated <em>pub4</em> mutant lines induced by 100 nM flg22<sup>Paer</sup> (A), 100 nM elf18<sup>Ecol</sup> (B), 1 μM AtPep1 (C) and 1 mg/mL chitin (D). ROS was measured as relative luminescence units (RLU) over time. Values are means ± SE (n=16 biological replicates).</p><p>(E) flg22-triggered MAPK activation in <em>pub4</em> T-DNA mutants. 100 nM flg22<sup>Pto</sup> was used to treat Arabidopsis seedlings and the samples were collected at indicated time points for western blots. Immunoblots were analyzed using anti-pMAPK and anti-FLS2 antibodies. Coomassie brilliant blue (CBB) staining was used as loading control. Molecular weight (kDa) marker bands are indicated for reference.</p><p>(F-G) PUB4 contributes to seedling growth inhibition induced by 100 nM flg22<sup>Paer</sup> (F) or 100 nM elf18<sup>Ecol</sup> (G). Values represent the percentage of fresh weight of PAMP-treated vs water-treated seedlings, and are means ± SE (n=16 biological replicates). Asterisks indicate significant differences compared to Col-0 (one-way ANOVA, Kruskal-Wallis test, Dunn's multiple comparisons test, *** p<0.001, ****p<0.0001).</p><p>(H-J) PUB4 contributes to PAMP-induced stomatal closure. Stomatal apertures were measured as width to length ratio 2 h after treatment with mock or 10 μM flg22<sup>Paer</sup> (H), 1 mg/mL chitin (I) and 10 μM ABA (J). Values are mean ± SE (n>120). Asterisks indicate significant differences between samples (one-way ANOVA, Kruskal-Wallis test, Dunn's multiple comparisons test, ****p<0.0001, <sup>ns</sup>p>0.05).</p><p>(K) <em>pub4</em> mutant lines display elevated susceptibility to <em>Pto</em> DC3000 COR<em><sup>-</sup></em> and <em>Pto</em> DC3000 Δ<em>hrcC</em>. Arabidopsis plants were spray-inoculated with indicated <em>Pto</em> strains and bacterial titers were determined 3 days post-inoculation. Values are means ± SE (n=6 biological replicates). Asterisks indicate significant differences compared to Col-0 (Student's t test, ** p<0.01).</p><p>Data information: Experiments were performed 3 times with similar results.</p>
|
https://api.sourcedata.io/file.php?figure_id=50310
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "816846",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "816846",
"original_type": "gene",
"role": "intervention",
"text": "pub4",
"type": "geneprod",
"uniprot_ids": [
"O22193",
"A0A1P8AYN7",
"F4ILG6"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9FL28",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "FLS2",
"type": "geneprod",
"uniprot_ids": [
"Q9FL28"
]
}
] |
||
10.15252/embj.2020107257
|
The Arabidopsis E3 ubiquitin ligase PUB4 regulates BIK1 and is targeted by a bacterial type-III effector
|
2022
|
Figure 5
|
<p><strong>Figure 5. PUB4 associates with PRR complexes</strong></p><p><strong>(A) PUB4 associates in <em>Arabidopsis</em> with EFR, BAK1, and SERK2 after 1</strong> μM <strong>elf18</strong><sup>Ecol</sup> <strong>treatment, and constitutively with XLG2 and XLG1. PRR complex members were identified after immunoprecipitation of PUB4-FLAG from <em>35S:PUB4-FLAG</em> line, tryptic digestion and sample analyses by LC-MS/MS. Untransformed Col-0 seedlings were used as a negative control. Total spectrum count for each protein is shown.</strong></p><p><strong>(B) Co-immunoprecipitation of PUB4 and BIK1 in <em>N. benthamiana.</em> PUB4-GFP or GFP-LTI6b were transiently co-expressed with BIK1-HA in the leaves of <em>N. benthamiana.</em> After treatment with mock or 1</strong> μM <strong>flg22</strong><sup>Paer</sup> <strong>for 10 min, total proteins (input) were extracted and subjected for immunoprecipitation with anti-GFP beads.</strong></p><p><strong>(C) Co-immunoprecipitation of PUB4 with PRR complex members in <em>Arabidopsis</em>. PUB4 co-immunoprecipitated with FLS2 and BAK1 specifically after 10 min of 1</strong> μM <strong>flg22</strong><sup>Paer</sup> <strong>treatment, and constantly with BIK1. Total protein extracts (input) from Col-0 and <em>PUB4-FLAG</em> plants were subjected to immunoprecipitation with anti-FLAG beads.</strong></p><p><strong>(D) PUB4 directly interacts with BIK1 <em>in vitro</em>.</strong> Immunoblots were analyzed using the indicated antibodies. Molecular weight (kDa) marker bands are indicated for reference.</p><p>Data information: Experiments in (B-D) were performed 3 times with similar results.</p>
|
https://api.sourcedata.io/file.php?figure_id=50312
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "816846",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "816846",
"original_type": "gene",
"role": "intervention",
"text": "PUB4",
"type": "geneprod",
"uniprot_ids": [
"O22193",
"A0A1P8AYN7",
"F4ILG6"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O48814",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BIK1",
"type": "geneprod",
"uniprot_ids": [
"O48814"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O22193",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PUB4",
"type": "geneprod",
"uniprot_ids": [
"O22193"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "816846",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "816846",
"original_type": "gene",
"role": "intervention",
"text": "PUB4",
"type": "geneprod",
"uniprot_ids": [
"O22193",
"A0A1P8AYN7",
"F4ILG6"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q94F62",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BAK1",
"type": "geneprod",
"uniprot_ids": [
"Q94F62"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O48814",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "BIK1",
"type": "geneprod",
"uniprot_ids": [
"O48814"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "Q9FL28",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "FLS2",
"type": "geneprod",
"uniprot_ids": [
"Q9FL28"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O22193",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PUB4",
"type": "geneprod",
"uniprot_ids": [
"O22193"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O22193",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PUB4",
"type": "geneprod",
"uniprot_ids": [
"O22193"
]
}
] |
||
10.15252/embj.2020107257
|
The Arabidopsis E3 ubiquitin ligase PUB4 regulates BIK1 and is targeted by a bacterial type-III effector
|
2022
|
Figure 6
|
<p><strong>Figure 6. RipAC does not affect PUB4 association with PRRs and BIK1.</strong></p><p>RipAC does not affect PUB4 association with PRR complex members. <em>PUB4-FLAG, PUB4-FLAG RipAC-GFP</em> and Col-0 plants were treated for 10 min with water (as mock) or 1 μM flg22<sup>Paer</sup> and elf18<sup>Ecol</sup> treatment. Total protein extracts (input) were subjected for immunoprecipitation with <strong>anti</strong>-FLAG beads. Immunoblots were analyzed using the indicated antibodies. Molecular weight (kDa) marker bands are indicated for reference. Data information: The experiment was performed 3 times with similar results.</p>
|
https://api.sourcedata.io/file.php?figure_id=50313
|
[
{
"ext_dbs": "NCBI gene",
"ext_ids": "2831203",
"ext_tax_ids": "267608",
"ext_tax_names": "Ralstonia solanacearum GMI1000",
"mapping_source": "unmapped",
"mapping_status": "unmapped",
"ncbi_gene_id": "2831203",
"original_type": "gene",
"role": "intervention",
"text": "RipAC",
"type": "geneprod",
"uniprot_ids": []
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "816846",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "816846",
"original_type": "gene",
"role": "intervention",
"text": "PUB4",
"type": "geneprod",
"uniprot_ids": [
"O22193",
"A0A1P8AYN7",
"F4ILG6"
]
},
{
"ext_dbs": "NCBI gene",
"ext_ids": "816846",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "ncbi_gene",
"mapping_status": "mapped",
"ncbi_gene_id": "816846",
"original_type": "gene",
"role": "intervention",
"text": "PUB4",
"type": "geneprod",
"uniprot_ids": [
"O22193",
"A0A1P8AYN7",
"F4ILG6"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "O22193",
"ext_tax_ids": "3702",
"ext_tax_names": "Arabidopsis thaliana",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "PUB4",
"type": "geneprod",
"uniprot_ids": [
"O22193"
]
},
{
"ext_dbs": "Uniprot",
"ext_ids": "A0A7U7JE71",
"ext_tax_ids": "564066",
"ext_tax_names": "Ralstonia solanacearum IPO1609",
"mapping_source": "direct",
"mapping_status": "mapped",
"ncbi_gene_id": null,
"original_type": "protein",
"role": "assayed",
"text": "RipAC",
"type": "geneprod",
"uniprot_ids": [
"A0A7U7JE71"
]
}
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.